Incidental Mutation 'R6718:Hoxc5'
ID529474
Institutional Source Beutler Lab
Gene Symbol Hoxc5
Ensembl Gene ENSMUSG00000022485
Gene Namehomeobox C5
SynonymsHox-3.4, Hox-6.2
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.532) question?
Stock #R6718 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location102967443-103017429 bp(+) (GRCm38)
Type of Mutationsplice site (2385 bp from exon)
DNA Base Change (assembly) A to G at 103014266 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000001711 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001709] [ENSMUST00000001711] [ENSMUST00000165375]
Predicted Effect probably benign
Transcript: ENSMUST00000001709
AA Change: D62G

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000001709
Gene: ENSMUSG00000022485
AA Change: D62G

DomainStartEndE-ValueType
low complexity region 69 85 N/A INTRINSIC
HOX 155 217 3.03e-26 SMART
Predicted Effect probably null
Transcript: ENSMUST00000001711
SMART Domains Protein: ENSMUSP00000001711
Gene: ENSMUSG00000001661

DomainStartEndE-ValueType
HOX 141 203 2.39e-24 SMART
low complexity region 221 235 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000102056
Predicted Effect probably benign
Transcript: ENSMUST00000165375
SMART Domains Protein: ENSMUSP00000133561
Gene: ENSMUSG00000075394

DomainStartEndE-ValueType
low complexity region 46 68 N/A INTRINSIC
low complexity region 80 91 N/A INTRINSIC
low complexity region 100 122 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173210
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173421
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174869
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the homeobox family of genes. The homeobox genes encode a highly conserved family of transcription factors that play an important role in morphogenesis in all multicellular organisms. Mammals possess four similar homeobox gene clusters, HOXA, HOXB, HOXC and HOXD, which are located on different chromosomes and consist of 9 to 11 genes arranged in tandem. This gene, HOXC5, is one of several homeobox HOXC genes located in a cluster on chromosome 12. Three genes, HOXC5, HOXC4 and HOXC6, share a 5' non-coding exon. Transcripts may include the shared exon spliced to the gene-specific exons, or they may include only the gene-specific exons. Two alternatively spliced variants have been described for HOXC5. The transcript variant which includes the shared exon apparently doesn't encode a protein. The protein-coding transcript variant contains gene-specific exons only. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afg3l2 G A 18: 67,421,276 T452I probably damaging Het
Asb8 A G 15: 98,136,134 I180T probably benign Het
Cdh18 A G 15: 23,226,749 T45A probably benign Het
Col12a1 T A 9: 79,699,605 Y512F probably damaging Het
Col6a1 A G 10: 76,725,050 F38S probably damaging Het
Kmt2d TATGCTGCTG TATGCTGCTGATGCTGCTG 15: 98,849,586 probably benign Het
Kmt2d C T 15: 98,850,539 probably benign Het
Lrp2 G T 2: 69,483,780 H2202Q probably benign Het
Maf C A 8: 115,706,800 V22F unknown Het
Mrgpra3 C T 7: 47,589,696 V161M probably benign Het
Olfr853 G T 9: 19,537,199 H244N probably damaging Het
Otx1 T C 11: 21,996,412 probably benign Het
Parvb C T 15: 84,297,979 R237W probably damaging Het
Pex11a A G 7: 79,737,482 F201L probably benign Het
Pigu A G 2: 155,301,286 Y232H possibly damaging Het
Pms2 T C 5: 143,923,489 I40T probably damaging Het
Pura A G 18: 36,287,643 N161S probably damaging Het
Ranbp10 A G 8: 105,774,628 V330A possibly damaging Het
Slc30a9 T C 5: 67,333,100 V218A probably damaging Het
Spindoc C T 19: 7,358,416 V336I probably damaging Het
Tmprss9 A G 10: 80,890,364 T483A probably benign Het
Other mutations in Hoxc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03339:Hoxc5 APN 15 103014136 missense probably damaging 0.98
R0386:Hoxc5 UTSW 15 103015352 nonsense probably null
R1797:Hoxc5 UTSW 15 103014434 missense probably benign 0.00
R2021:Hoxc5 UTSW 15 103014382 splice site probably null
R4851:Hoxc5 UTSW 15 103015369 missense probably damaging 1.00
R4967:Hoxc5 UTSW 15 103015354 missense probably damaging 1.00
R5089:Hoxc5 UTSW 15 103014055 unclassified probably benign
R6784:Hoxc5 UTSW 15 103013890 unclassified probably benign
R6927:Hoxc5 UTSW 15 103015375 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGCTCCTACGTAGCCAATTC -3'
(R):5'- TGGTCATCCACGGGTAAATCTG -3'

Sequencing Primer
(F):5'- GCCAATTCATTCTATAAGCAGAGC -3'
(R):5'- CACGGGTAAATCTGTGGCG -3'
Posted On2018-08-01