Incidental Mutation 'R6719:Terf1'
ID529478
Institutional Source Beutler Lab
Gene Symbol Terf1
Ensembl Gene ENSMUSG00000025925
Gene Nametelomeric repeat binding factor 1
SynonymsTrbf1, Trf1, Pin2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6719 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location15805646-15844052 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 15838236 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 351 (V351A)
Ref Sequence ENSEMBL: ENSMUSP00000140744 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027057] [ENSMUST00000188371]
Predicted Effect probably benign
Transcript: ENSMUST00000027057
AA Change: V322A

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000027057
Gene: ENSMUSG00000025925
AA Change: V322A

DomainStartEndE-ValueType
Pfam:TRF 61 257 2.3e-28 PFAM
SANT 366 417 1.9e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188371
AA Change: V351A

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000140744
Gene: ENSMUSG00000025925
AA Change: V351A

DomainStartEndE-ValueType
Pfam:TRF 61 258 3e-30 PFAM
SANT 366 417 1.9e-15 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein that binds to repeats in telomeres to form a nucleoprotein complex that protects against the degradation of chromosomal ends. The encoded protein regulates the length of telomeres and is an integral structural component of the functional telomere. This protein is thought to play a role in spindle formation in mitosis. Mutations in this gene are associated with bone marrow failure. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Nov 2013]
PHENOTYPE: Mice homozygous for disruptions in this gene display embryonic lethality and die sometime before E7.5 [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933411K16Rik T C 19: 42,052,712 I94T possibly damaging Het
Afp T A 5: 90,503,703 N392K probably benign Het
Asrgl1 C T 19: 9,113,148 G278D probably damaging Het
Atp2c1 T C 9: 105,424,178 I611V probably damaging Het
Avl9 A G 6: 56,753,385 Y571C probably damaging Het
Clrn1 A T 3: 58,846,440 C167S probably damaging Het
Ctsr C T 13: 61,160,451 G293D possibly damaging Het
Dmbt1 T A 7: 131,119,603 S1867T possibly damaging Het
Dock9 A T 14: 121,610,027 I1025N probably damaging Het
Dppa4 G A 16: 48,287,884 A11T probably damaging Het
Duox2 T A 2: 122,284,386 probably null Het
Fat3 A G 9: 15,996,144 L2854P probably benign Het
Fcer1a A G 1: 173,222,773 S61P possibly damaging Het
Fyb2 A T 4: 105,010,459 D669V probably benign Het
Herc2 G T 7: 56,212,826 C4081F probably damaging Het
Hexim1 T C 11: 103,117,265 L115P probably benign Het
Kat2a T G 11: 100,712,141 Q88H probably benign Het
Lrriq1 T C 10: 103,071,116 Y1581C probably damaging Het
Ltbp4 T G 7: 27,328,763 D323A probably damaging Het
Mark3 T A 12: 111,615,442 I115K probably damaging Het
Nudt9 A G 5: 104,061,696 D271G probably damaging Het
Olfr441 T A 6: 43,115,973 V77D probably damaging Het
Parvb C T 15: 84,297,979 R237W probably damaging Het
Pcdha5 T C 18: 36,960,872 S145P probably damaging Het
Pzp T C 6: 128,524,083 E104G probably benign Het
Rho T C 6: 115,933,893 I133T possibly damaging Het
Sall3 G T 18: 80,971,506 T997K probably damaging Het
Scn8a A T 15: 101,011,015 probably null Het
Sfxn1 T A 13: 54,106,564 H310Q probably benign Het
Slc25a18 A G 6: 120,788,254 D92G probably damaging Het
Slc26a9 T C 1: 131,761,785 I490T probably benign Het
Thsd7b A G 1: 130,159,714 probably null Het
Trgj2 A G 13: 19,311,256 probably benign Het
Tti1 A T 2: 157,982,300 C1078S probably benign Het
Ttll3 A G 6: 113,399,032 probably benign Het
Tubb1 A C 2: 174,457,394 T290P probably damaging Het
Ugt2b35 G T 5: 87,007,388 D361Y probably damaging Het
Zc2hc1c T C 12: 85,290,672 S368P probably damaging Het
Other mutations in Terf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02302:Terf1 APN 1 15833402 missense probably damaging 1.00
R0358:Terf1 UTSW 1 15805838 missense possibly damaging 0.84
R0369:Terf1 UTSW 1 15818983 missense probably damaging 1.00
R1471:Terf1 UTSW 1 15842970 missense probably damaging 1.00
R1853:Terf1 UTSW 1 15818938 nonsense probably null
R1942:Terf1 UTSW 1 15805814 missense probably benign 0.34
R2029:Terf1 UTSW 1 15805946 missense possibly damaging 0.82
R2132:Terf1 UTSW 1 15805685 missense probably benign 0.02
R2391:Terf1 UTSW 1 15805739 nonsense probably null
R4255:Terf1 UTSW 1 15805679 start codon destroyed probably null 1.00
R4685:Terf1 UTSW 1 15818961 missense possibly damaging 0.80
R5291:Terf1 UTSW 1 15819086 splice site probably null
R5310:Terf1 UTSW 1 15805685 missense probably damaging 0.97
R5338:Terf1 UTSW 1 15831563 missense possibly damaging 0.48
R5661:Terf1 UTSW 1 15819664 missense probably damaging 1.00
R6216:Terf1 UTSW 1 15818997 missense probably benign 0.09
R7126:Terf1 UTSW 1 15813139 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CAGGGCTAAACAGAGAAACCCT -3'
(R):5'- GCGAAATGATGTAAACACTGAGG -3'

Sequencing Primer
(F):5'- CAGAGAAACCCTGTCTCGG -3'
(R):5'- GAATCTTTGAGTTCAAGGCCAGCC -3'
Posted On2018-08-01