Incidental Mutation 'R6719:Tubb1'
ID529484
Institutional Source Beutler Lab
Gene Symbol Tubb1
Ensembl Gene ENSMUSG00000016255
Gene Nametubulin, beta 1 class VI
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.219) question?
Stock #R6719 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location174450695-174457882 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 174457394 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Proline at position 290 (T290P)
Ref Sequence ENSEMBL: ENSMUSP00000016399 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016396] [ENSMUST00000016399]
Predicted Effect probably benign
Transcript: ENSMUST00000016396
SMART Domains Protein: ENSMUSP00000016396
Gene: ENSMUSG00000016252

DomainStartEndE-ValueType
Pfam:ATP-synt_Eps 2 51 7.8e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000016399
AA Change: T290P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000016399
Gene: ENSMUSG00000016255
AA Change: T290P

DomainStartEndE-ValueType
Tubulin 47 244 3.42e-68 SMART
Tubulin_C 246 383 1.84e-41 SMART
low complexity region 433 448 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149191
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the beta tubulin protein family. Beta tubulins are one of two core protein families (alpha and beta tubulins) that heterodimerize and assemble to form microtubules. This protein is specifically expressed in platelets and megakaryocytes and may be involved in proplatelet production and platelet release. A mutations in this gene is associated with autosomal dominant macrothrombocytopenia. Two pseudogenes of this gene are found on chromosome Y.[provided by RefSeq, Jul 2010]
PHENOTYPE: Homozygotes have thrombocytopenia resulting from a defect in generating proplatelets. The platelets that are produced have structural and functional defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933411K16Rik T C 19: 42,052,712 I94T possibly damaging Het
Afp T A 5: 90,503,703 N392K probably benign Het
Asrgl1 C T 19: 9,113,148 G278D probably damaging Het
Atp2c1 T C 9: 105,424,178 I611V probably damaging Het
Avl9 A G 6: 56,753,385 Y571C probably damaging Het
Clrn1 A T 3: 58,846,440 C167S probably damaging Het
Ctsr C T 13: 61,160,451 G293D possibly damaging Het
Dmbt1 T A 7: 131,119,603 S1867T possibly damaging Het
Dock9 A T 14: 121,610,027 I1025N probably damaging Het
Dppa4 G A 16: 48,287,884 A11T probably damaging Het
Duox2 T A 2: 122,284,386 probably null Het
Fat3 A G 9: 15,996,144 L2854P probably benign Het
Fcer1a A G 1: 173,222,773 S61P possibly damaging Het
Fyb2 A T 4: 105,010,459 D669V probably benign Het
Herc2 G T 7: 56,212,826 C4081F probably damaging Het
Hexim1 T C 11: 103,117,265 L115P probably benign Het
Kat2a T G 11: 100,712,141 Q88H probably benign Het
Lrriq1 T C 10: 103,071,116 Y1581C probably damaging Het
Ltbp4 T G 7: 27,328,763 D323A probably damaging Het
Mark3 T A 12: 111,615,442 I115K probably damaging Het
Nudt9 A G 5: 104,061,696 D271G probably damaging Het
Olfr441 T A 6: 43,115,973 V77D probably damaging Het
Parvb C T 15: 84,297,979 R237W probably damaging Het
Pcdha5 T C 18: 36,960,872 S145P probably damaging Het
Pzp T C 6: 128,524,083 E104G probably benign Het
Rho T C 6: 115,933,893 I133T possibly damaging Het
Sall3 G T 18: 80,971,506 T997K probably damaging Het
Scn8a A T 15: 101,011,015 probably null Het
Sfxn1 T A 13: 54,106,564 H310Q probably benign Het
Slc25a18 A G 6: 120,788,254 D92G probably damaging Het
Slc26a9 T C 1: 131,761,785 I490T probably benign Het
Terf1 T C 1: 15,838,236 V351A probably benign Het
Thsd7b A G 1: 130,159,714 probably null Het
Trgj2 A G 13: 19,311,256 probably benign Het
Tti1 A T 2: 157,982,300 C1078S probably benign Het
Ttll3 A G 6: 113,399,032 probably benign Het
Ugt2b35 G T 5: 87,007,388 D361Y probably damaging Het
Zc2hc1c T C 12: 85,290,672 S368P probably damaging Het
Other mutations in Tubb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01877:Tubb1 APN 2 174456898 missense possibly damaging 0.87
IGL02534:Tubb1 APN 2 174455669 missense probably benign 0.04
IGL02535:Tubb1 APN 2 174457566 missense probably benign 0.00
IGL03404:Tubb1 APN 2 174457448 missense probably damaging 1.00
R0117:Tubb1 UTSW 2 174457784 missense probably benign 0.00
R0666:Tubb1 UTSW 2 174457755 missense probably damaging 0.98
R0939:Tubb1 UTSW 2 174455756 missense probably damaging 1.00
R1163:Tubb1 UTSW 2 174457739 missense probably benign
R1317:Tubb1 UTSW 2 174456896 missense probably benign 0.16
R1458:Tubb1 UTSW 2 174450803 critical splice donor site probably null
R1574:Tubb1 UTSW 2 174457422 missense probably benign
R1574:Tubb1 UTSW 2 174457422 missense probably benign
R1658:Tubb1 UTSW 2 174456623 missense probably damaging 1.00
R1751:Tubb1 UTSW 2 174456896 missense probably benign 0.16
R1761:Tubb1 UTSW 2 174456896 missense probably benign 0.16
R1869:Tubb1 UTSW 2 174456689 missense probably benign 0.00
R1969:Tubb1 UTSW 2 174455691 missense possibly damaging 0.92
R2412:Tubb1 UTSW 2 174457110 missense possibly damaging 0.71
R4249:Tubb1 UTSW 2 174455733 missense probably null 0.93
R4415:Tubb1 UTSW 2 174457673 missense probably benign 0.12
R5154:Tubb1 UTSW 2 174456864 missense probably benign 0.19
R5276:Tubb1 UTSW 2 174457424 missense probably damaging 0.97
R5730:Tubb1 UTSW 2 174457769 missense probably benign
R6008:Tubb1 UTSW 2 174457774 missense probably benign 0.00
R7422:Tubb1 UTSW 2 174457032 missense possibly damaging 0.76
X0063:Tubb1 UTSW 2 174457295 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GAGCGGAATCACGACTTCAC -3'
(R):5'- GGAAGGTAGCTGCCATGTTC -3'

Sequencing Primer
(F):5'- GGAATCACGACTTCACTGCGC -3'
(R):5'- CAGCTACCTTGACATTGTTGGGAATC -3'
Posted On2018-08-01