Incidental Mutation 'R6719:Olfr441'
ID529490
Institutional Source Beutler Lab
Gene Symbol Olfr441
Ensembl Gene ENSMUSG00000094669
Gene Nameolfactory receptor 441
SynonymsMOR261-3, GA_x6K02T2P3E9-4442577-4441645
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R6719 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location43106369-43117803 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 43115973 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 77 (V77D)
Ref Sequence ENSEMBL: ENSMUSP00000150572 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095954] [ENSMUST00000213649]
Predicted Effect probably damaging
Transcript: ENSMUST00000095954
AA Change: V77D

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000093648
Gene: ENSMUSG00000094669
AA Change: V77D

DomainStartEndE-ValueType
Pfam:7tm_4 30 307 8.6e-60 PFAM
Pfam:7tm_1 40 289 3.5e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213649
AA Change: V77D

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933411K16Rik T C 19: 42,052,712 I94T possibly damaging Het
Afp T A 5: 90,503,703 N392K probably benign Het
Asrgl1 C T 19: 9,113,148 G278D probably damaging Het
Atp2c1 T C 9: 105,424,178 I611V probably damaging Het
Avl9 A G 6: 56,753,385 Y571C probably damaging Het
Clrn1 A T 3: 58,846,440 C167S probably damaging Het
Ctsr C T 13: 61,160,451 G293D possibly damaging Het
Dmbt1 T A 7: 131,119,603 S1867T possibly damaging Het
Dock9 A T 14: 121,610,027 I1025N probably damaging Het
Dppa4 G A 16: 48,287,884 A11T probably damaging Het
Duox2 T A 2: 122,284,386 probably null Het
Fat3 A G 9: 15,996,144 L2854P probably benign Het
Fcer1a A G 1: 173,222,773 S61P possibly damaging Het
Fyb2 A T 4: 105,010,459 D669V probably benign Het
Herc2 G T 7: 56,212,826 C4081F probably damaging Het
Hexim1 T C 11: 103,117,265 L115P probably benign Het
Kat2a T G 11: 100,712,141 Q88H probably benign Het
Lrriq1 T C 10: 103,071,116 Y1581C probably damaging Het
Ltbp4 T G 7: 27,328,763 D323A probably damaging Het
Mark3 T A 12: 111,615,442 I115K probably damaging Het
Nudt9 A G 5: 104,061,696 D271G probably damaging Het
Parvb C T 15: 84,297,979 R237W probably damaging Het
Pcdha5 T C 18: 36,960,872 S145P probably damaging Het
Pzp T C 6: 128,524,083 E104G probably benign Het
Rho T C 6: 115,933,893 I133T possibly damaging Het
Sall3 G T 18: 80,971,506 T997K probably damaging Het
Scn8a A T 15: 101,011,015 probably null Het
Sfxn1 T A 13: 54,106,564 H310Q probably benign Het
Slc25a18 A G 6: 120,788,254 D92G probably damaging Het
Slc26a9 T C 1: 131,761,785 I490T probably benign Het
Terf1 T C 1: 15,838,236 V351A probably benign Het
Thsd7b A G 1: 130,159,714 probably null Het
Trgj2 A G 13: 19,311,256 probably benign Het
Tti1 A T 2: 157,982,300 C1078S probably benign Het
Ttll3 A G 6: 113,399,032 probably benign Het
Tubb1 A C 2: 174,457,394 T290P probably damaging Het
Ugt2b35 G T 5: 87,007,388 D361Y probably damaging Het
Zc2hc1c T C 12: 85,290,672 S368P probably damaging Het
Other mutations in Olfr441
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0470:Olfr441 UTSW 6 43116624 missense probably null 0.04
R0528:Olfr441 UTSW 6 43116216 missense possibly damaging 0.56
R1441:Olfr441 UTSW 6 43115946 missense probably benign 0.02
R2048:Olfr441 UTSW 6 43116378 missense probably benign 0.00
R2191:Olfr441 UTSW 6 43116065 missense probably benign 0.13
R4438:Olfr441 UTSW 6 43116287 missense probably benign 0.09
R4465:Olfr441 UTSW 6 43115918 missense probably damaging 0.97
R5191:Olfr441 UTSW 6 43115866 missense probably damaging 1.00
R6353:Olfr441 UTSW 6 43116136 nonsense probably null
Z1177:Olfr441 UTSW 6 43116235 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGGATTCCAAGCTGACCTAG -3'
(R):5'- GGAGACAGCAGCCATTATGG -3'

Sequencing Primer
(F):5'- ACCTAGCTGTGGAGTGTTTCCTC -3'
(R):5'- TCCAGCTCATGATGACAGTG -3'
Posted On2018-08-01