Incidental Mutation 'R6719:Slc25a18'
ID529494
Institutional Source Beutler Lab
Gene Symbol Slc25a18
Ensembl Gene ENSMUSG00000004902
Gene Namesolute carrier family 25 (mitochondrial carrier), member 18
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6719 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location120773578-120794336 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 120788254 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 92 (D92G)
Ref Sequence ENSEMBL: ENSMUSP00000108302 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112682]
Predicted Effect probably damaging
Transcript: ENSMUST00000112682
AA Change: D92G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108302
Gene: ENSMUSG00000004902
AA Change: D92G

DomainStartEndE-ValueType
Pfam:Mito_carr 9 102 6.8e-27 PFAM
Pfam:Mito_carr 104 218 1.2e-17 PFAM
Pfam:Mito_carr 222 310 7.9e-20 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933411K16Rik T C 19: 42,052,712 I94T possibly damaging Het
Afp T A 5: 90,503,703 N392K probably benign Het
Asrgl1 C T 19: 9,113,148 G278D probably damaging Het
Atp2c1 T C 9: 105,424,178 I611V probably damaging Het
Avl9 A G 6: 56,753,385 Y571C probably damaging Het
Clrn1 A T 3: 58,846,440 C167S probably damaging Het
Ctsr C T 13: 61,160,451 G293D possibly damaging Het
Dmbt1 T A 7: 131,119,603 S1867T possibly damaging Het
Dock9 A T 14: 121,610,027 I1025N probably damaging Het
Dppa4 G A 16: 48,287,884 A11T probably damaging Het
Duox2 T A 2: 122,284,386 probably null Het
Fat3 A G 9: 15,996,144 L2854P probably benign Het
Fcer1a A G 1: 173,222,773 S61P possibly damaging Het
Fyb2 A T 4: 105,010,459 D669V probably benign Het
Herc2 G T 7: 56,212,826 C4081F probably damaging Het
Hexim1 T C 11: 103,117,265 L115P probably benign Het
Kat2a T G 11: 100,712,141 Q88H probably benign Het
Lrriq1 T C 10: 103,071,116 Y1581C probably damaging Het
Ltbp4 T G 7: 27,328,763 D323A probably damaging Het
Mark3 T A 12: 111,615,442 I115K probably damaging Het
Nudt9 A G 5: 104,061,696 D271G probably damaging Het
Olfr441 T A 6: 43,115,973 V77D probably damaging Het
Parvb C T 15: 84,297,979 R237W probably damaging Het
Pcdha5 T C 18: 36,960,872 S145P probably damaging Het
Pzp T C 6: 128,524,083 E104G probably benign Het
Rho T C 6: 115,933,893 I133T possibly damaging Het
Sall3 G T 18: 80,971,506 T997K probably damaging Het
Scn8a A T 15: 101,011,015 probably null Het
Sfxn1 T A 13: 54,106,564 H310Q probably benign Het
Slc26a9 T C 1: 131,761,785 I490T probably benign Het
Terf1 T C 1: 15,838,236 V351A probably benign Het
Thsd7b A G 1: 130,159,714 probably null Het
Trgj2 A G 13: 19,311,256 probably benign Het
Tti1 A T 2: 157,982,300 C1078S probably benign Het
Ttll3 A G 6: 113,399,032 probably benign Het
Tubb1 A C 2: 174,457,394 T290P probably damaging Het
Ugt2b35 G T 5: 87,007,388 D361Y probably damaging Het
Zc2hc1c T C 12: 85,290,672 S368P probably damaging Het
Other mutations in Slc25a18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02054:Slc25a18 APN 6 120792397 unclassified probably null
R1066:Slc25a18 UTSW 6 120788288 splice site probably null
R1618:Slc25a18 UTSW 6 120786342 splice site probably benign
R2220:Slc25a18 UTSW 6 120793557 unclassified probably null
R4715:Slc25a18 UTSW 6 120786090 missense probably damaging 1.00
R5786:Slc25a18 UTSW 6 120792074 missense probably damaging 0.99
R5873:Slc25a18 UTSW 6 120786281 critical splice acceptor site probably null
R6103:Slc25a18 UTSW 6 120789438 missense probably damaging 1.00
R8032:Slc25a18 UTSW 6 120792491 missense probably damaging 1.00
Z1176:Slc25a18 UTSW 6 120789365 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TGTCATGCTGGACCGTGTAC -3'
(R):5'- TGAATATACAGTCTCTCCCCGC -3'

Sequencing Primer
(F):5'- TCATGCTGGACCGTGTACTAAGAC -3'
(R):5'- AATATACAGTCTCTCCCCGCTTACAC -3'
Posted On2018-08-01