Incidental Mutation 'R6719:Pzp'
ID529495
Institutional Source Beutler Lab
Gene Symbol Pzp
Ensembl Gene ENSMUSG00000030359
Gene NamePZP, alpha-2-macroglobulin like
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.117) question?
Stock #R6719 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location128483567-128526720 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 128524083 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 104 (E104G)
Ref Sequence ENSEMBL: ENSMUSP00000120114 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112132] [ENSMUST00000143664]
Predicted Effect probably benign
Transcript: ENSMUST00000112132
AA Change: E104G

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000107760
Gene: ENSMUSG00000030359
AA Change: E104G

DomainStartEndE-ValueType
low complexity region 11 18 N/A INTRINSIC
Pfam:A2M_N 126 219 3.2e-23 PFAM
low complexity region 327 338 N/A INTRINSIC
A2M_N_2 458 606 6.18e-40 SMART
A2M 750 840 2.27e-38 SMART
Pfam:Thiol-ester_cl 973 1003 4e-19 PFAM
Pfam:A2M_comp 1022 1284 2.1e-90 PFAM
A2M_recep 1395 1482 6.47e-43 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000143664
AA Change: E104G

PolyPhen 2 Score 0.169 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000120114
Gene: ENSMUSG00000030359
AA Change: E104G

DomainStartEndE-ValueType
low complexity region 11 18 N/A INTRINSIC
Pfam:A2M_N 126 212 4.8e-21 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygotes mutant null mice show higher bone mineral density, hypoactivity, and decreased heart rate. Mice homozygous for a different null allele show resistance to the lethal effects of endotoxin, increased susceptibility to diet-induced acute pancreatitis, and altered LPS-induced febrile and cytokine responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933411K16Rik T C 19: 42,052,712 I94T possibly damaging Het
Afp T A 5: 90,503,703 N392K probably benign Het
Asrgl1 C T 19: 9,113,148 G278D probably damaging Het
Atp2c1 T C 9: 105,424,178 I611V probably damaging Het
Avl9 A G 6: 56,753,385 Y571C probably damaging Het
Clrn1 A T 3: 58,846,440 C167S probably damaging Het
Ctsr C T 13: 61,160,451 G293D possibly damaging Het
Dmbt1 T A 7: 131,119,603 S1867T possibly damaging Het
Dock9 A T 14: 121,610,027 I1025N probably damaging Het
Dppa4 G A 16: 48,287,884 A11T probably damaging Het
Duox2 T A 2: 122,284,386 probably null Het
Fat3 A G 9: 15,996,144 L2854P probably benign Het
Fcer1a A G 1: 173,222,773 S61P possibly damaging Het
Fyb2 A T 4: 105,010,459 D669V probably benign Het
Herc2 G T 7: 56,212,826 C4081F probably damaging Het
Hexim1 T C 11: 103,117,265 L115P probably benign Het
Kat2a T G 11: 100,712,141 Q88H probably benign Het
Lrriq1 T C 10: 103,071,116 Y1581C probably damaging Het
Ltbp4 T G 7: 27,328,763 D323A probably damaging Het
Mark3 T A 12: 111,615,442 I115K probably damaging Het
Nudt9 A G 5: 104,061,696 D271G probably damaging Het
Olfr441 T A 6: 43,115,973 V77D probably damaging Het
Parvb C T 15: 84,297,979 R237W probably damaging Het
Pcdha5 T C 18: 36,960,872 S145P probably damaging Het
Rho T C 6: 115,933,893 I133T possibly damaging Het
Sall3 G T 18: 80,971,506 T997K probably damaging Het
Scn8a A T 15: 101,011,015 probably null Het
Sfxn1 T A 13: 54,106,564 H310Q probably benign Het
Slc25a18 A G 6: 120,788,254 D92G probably damaging Het
Slc26a9 T C 1: 131,761,785 I490T probably benign Het
Terf1 T C 1: 15,838,236 V351A probably benign Het
Thsd7b A G 1: 130,159,714 probably null Het
Trgj2 A G 13: 19,311,256 probably benign Het
Tti1 A T 2: 157,982,300 C1078S probably benign Het
Ttll3 A G 6: 113,399,032 probably benign Het
Tubb1 A C 2: 174,457,394 T290P probably damaging Het
Ugt2b35 G T 5: 87,007,388 D361Y probably damaging Het
Zc2hc1c T C 12: 85,290,672 S368P probably damaging Het
Other mutations in Pzp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Pzp APN 6 128516909 missense probably benign 0.25
IGL01470:Pzp APN 6 128521124 missense probably benign 0.05
IGL01753:Pzp APN 6 128502183 missense possibly damaging 0.78
IGL01878:Pzp APN 6 128495298 missense probably damaging 1.00
IGL02307:Pzp APN 6 128489086 nonsense probably null
IGL02338:Pzp APN 6 128486170 missense probably benign 0.07
IGL02546:Pzp APN 6 128494699 splice site probably benign
IGL02598:Pzp APN 6 128487457 missense probably benign 0.00
IGL02699:Pzp APN 6 128487401 critical splice donor site probably null
lilibet UTSW 6 128513773 missense probably damaging 0.99
P4748:Pzp UTSW 6 128490089 missense probably damaging 1.00
PIT4151001:Pzp UTSW 6 128525296 missense probably benign 0.34
PIT4495001:Pzp UTSW 6 128502229 missense probably benign
R0157:Pzp UTSW 6 128523976 nonsense probably null
R0195:Pzp UTSW 6 128487478 missense probably damaging 1.00
R0238:Pzp UTSW 6 128489156 splice site probably benign
R0239:Pzp UTSW 6 128489156 splice site probably benign
R0271:Pzp UTSW 6 128519514 missense probably damaging 1.00
R0299:Pzp UTSW 6 128495330 splice site probably benign
R0744:Pzp UTSW 6 128516195 unclassified probably benign
R0968:Pzp UTSW 6 128525145 missense probably benign 0.00
R1037:Pzp UTSW 6 128519426 missense probably benign 0.01
R1074:Pzp UTSW 6 128487924 missense probably benign 0.20
R1469:Pzp UTSW 6 128512356 missense probably benign 0.04
R1469:Pzp UTSW 6 128512356 missense probably benign 0.04
R1579:Pzp UTSW 6 128523968 critical splice donor site probably null
R1646:Pzp UTSW 6 128503555 missense probably benign 0.33
R1770:Pzp UTSW 6 128485617 missense probably damaging 1.00
R1777:Pzp UTSW 6 128490572 missense possibly damaging 0.85
R1786:Pzp UTSW 6 128491161 splice site probably null
R1854:Pzp UTSW 6 128502225 missense probably damaging 1.00
R2001:Pzp UTSW 6 128516120 missense probably benign 0.01
R2060:Pzp UTSW 6 128483710 missense probably benign 0.45
R2081:Pzp UTSW 6 128519420 missense probably benign 0.00
R2130:Pzp UTSW 6 128491161 splice site probably null
R2131:Pzp UTSW 6 128491161 splice site probably null
R2160:Pzp UTSW 6 128525276 missense probably damaging 1.00
R2168:Pzp UTSW 6 128488047 missense probably damaging 0.98
R2328:Pzp UTSW 6 128510390 missense possibly damaging 0.79
R2441:Pzp UTSW 6 128489768 nonsense probably null
R2866:Pzp UTSW 6 128525264 missense possibly damaging 0.76
R2869:Pzp UTSW 6 128485556 critical splice donor site probably null
R2869:Pzp UTSW 6 128485556 critical splice donor site probably null
R2870:Pzp UTSW 6 128485556 critical splice donor site probably null
R2870:Pzp UTSW 6 128485556 critical splice donor site probably null
R2873:Pzp UTSW 6 128485556 critical splice donor site probably null
R2876:Pzp UTSW 6 128491550 missense probably damaging 1.00
R3404:Pzp UTSW 6 128513806 missense probably damaging 1.00
R4452:Pzp UTSW 6 128491240 missense probably damaging 1.00
R4461:Pzp UTSW 6 128524040 missense probably benign 0.02
R5103:Pzp UTSW 6 128502229 missense probably benign 0.04
R5193:Pzp UTSW 6 128502334 missense probably benign 0.00
R5425:Pzp UTSW 6 128489048 missense probably damaging 0.97
R5465:Pzp UTSW 6 128486961 missense probably damaging 1.00
R5590:Pzp UTSW 6 128523796 missense probably damaging 1.00
R5656:Pzp UTSW 6 128490072 missense probably damaging 0.99
R5697:Pzp UTSW 6 128525189 missense probably benign 0.03
R5854:Pzp UTSW 6 128506869 missense probably benign 0.01
R5994:Pzp UTSW 6 128491597 missense probably damaging 1.00
R6042:Pzp UTSW 6 128524014 missense possibly damaging 0.75
R6054:Pzp UTSW 6 128513764 missense probably benign 0.03
R6153:Pzp UTSW 6 128489016 missense probably benign
R6465:Pzp UTSW 6 128491619 missense probably damaging 1.00
R6722:Pzp UTSW 6 128487954 missense probably damaging 1.00
R7316:Pzp UTSW 6 128513773 missense probably damaging 0.99
R7453:Pzp UTSW 6 128486916 missense probably damaging 1.00
R7826:Pzp UTSW 6 128487533 missense probably benign 0.38
R7878:Pzp UTSW 6 128512311 missense possibly damaging 0.50
R7879:Pzp UTSW 6 128489016 missense probably benign
R7961:Pzp UTSW 6 128512311 missense possibly damaging 0.50
R7962:Pzp UTSW 6 128489016 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAGGCCAGAGTTCCCATGAC -3'
(R):5'- TGCACTGAAGAATGGTCTGTTG -3'

Sequencing Primer
(F):5'- GAGTTCCCATGACTGCAGTTTAATCG -3'
(R):5'- CTCCTAAAATCATGTTACTTGGGCAC -3'
Posted On2018-08-01