Mutagenetix > Incidental Mutation

Incidental Mutation 'R6719:Lrriq1'

529501

Institutional Source

Beutler Lab

Gene Symbol

Lrriq1

Ensembl Gene

ENSMUSG00000019892

Gene Name

leucine-rich repeats and IQ motif containing 1

Synonyms

LOC380658, 4930503E15Rik, Gm1557

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.085) question?

Stock #

R6719 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

103046031-103236322 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 103071116 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 1581 (Y1581C)

Ref Sequence

ENSEMBL: ENSMUSP00000131419 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000166240]

AlphaFold

Q0P5X1

Predicted Effect

probably damaging
Transcript: ENSMUST00000166240
AA Change: Y1581C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000131419
Gene: ENSMUSG00000019892
AA Change: Y1581C

Domain	Start	End	E-Value	Type
coiled coil region	11	31	N/A	INTRINSIC
low complexity region	35	48	N/A	INTRINSIC
coiled coil region	183	286	N/A	INTRINSIC
IQ	290	312	9.78e1	SMART
coiled coil region	314	390	N/A	INTRINSIC
low complexity region	550	559	N/A	INTRINSIC
LRR	873	894	2.14e1	SMART
LRR	895	917	4.45e1	SMART
LRR	984	1005	2.03e2	SMART
LRR	1029	1052	3.65e0	SMART
low complexity region	1244	1258	N/A	INTRINSIC
IQ	1279	1301	5.61e1	SMART
IQ	1339	1361	6.7e-3	SMART
low complexity region	1369	1394	N/A	INTRINSIC
low complexity region	1502	1518	N/A	INTRINSIC
low complexity region	1528	1543	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000218841
AA Change: Y28C

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.4%
20x: 95.7%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933411K16Rik	T	C	19: 42,052,712	I94T	possibly damaging	Het
Afp	T	A	5: 90,503,703	N392K	probably benign	Het
Asrgl1	C	T	19: 9,113,148	G278D	probably damaging	Het
Atp2c1	T	C	9: 105,424,178	I611V	probably damaging	Het
Avl9	A	G	6: 56,753,385	Y571C	probably damaging	Het
Clrn1	A	T	3: 58,846,440	C167S	probably damaging	Het
Ctsr	C	T	13: 61,160,451	G293D	possibly damaging	Het
Dmbt1	T	A	7: 131,119,603	S1867T	possibly damaging	Het
Dock9	A	T	14: 121,610,027	I1025N	probably damaging	Het
Dppa4	G	A	16: 48,287,884	A11T	probably damaging	Het
Duox2	T	A	2: 122,284,386		probably null	Het
Fat3	A	G	9: 15,996,144	L2854P	probably benign	Het
Fcer1a	A	G	1: 173,222,773	S61P	possibly damaging	Het
Fyb2	A	T	4: 105,010,459	D669V	probably benign	Het
Herc2	G	T	7: 56,212,826	C4081F	probably damaging	Het
Hexim1	T	C	11: 103,117,265	L115P	probably benign	Het
Kat2a	T	G	11: 100,712,141	Q88H	probably benign	Het
Ltbp4	T	G	7: 27,328,763	D323A	probably damaging	Het
Mark3	T	A	12: 111,615,442	I115K	probably damaging	Het
Nudt9	A	G	5: 104,061,696	D271G	probably damaging	Het
Olfr441	T	A	6: 43,115,973	V77D	probably damaging	Het
Parvb	C	T	15: 84,297,979	R237W	probably damaging	Het
Pcdha5	T	C	18: 36,960,872	S145P	probably damaging	Het
Pzp	T	C	6: 128,524,083	E104G	probably benign	Het
Rho	T	C	6: 115,933,893	I133T	possibly damaging	Het
Sall3	G	T	18: 80,971,506	T997K	probably damaging	Het
Scn8a	A	T	15: 101,011,015		probably null	Het
Sfxn1	T	A	13: 54,106,564	H310Q	probably benign	Het
Slc25a18	A	G	6: 120,788,254	D92G	probably damaging	Het
Slc26a9	T	C	1: 131,761,785	I490T	probably benign	Het
Terf1	T	C	1: 15,838,236	V351A	probably benign	Het
Thsd7b	A	G	1: 130,159,714		probably null	Het
Trgj2	A	G	13: 19,311,256		probably benign	Het
Tti1	A	T	2: 157,982,300	C1078S	probably benign	Het
Ttll3	A	G	6: 113,399,032		probably benign	Het
Tubb1	A	C	2: 174,457,394	T290P	probably damaging	Het
Ugt2b35	G	T	5: 87,007,388	D361Y	probably damaging	Het
Zc2hc1c	T	C	12: 85,290,672	S368P	probably damaging	Het

Other mutations in Lrriq1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00988:Lrriq1	APN	10	103161896	missense	probably damaging	0.99
IGL01523:Lrriq1	APN	10	103218116	nonsense	probably null
IGL01637:Lrriq1	APN	10	103215628	missense	probably benign
IGL02019:Lrriq1	APN	10	103178800	missense	probably benign	0.02
IGL02153:Lrriq1	APN	10	103170479	missense	probably benign	0.01
IGL02341:Lrriq1	APN	10	103224941	missense	probably benign	0.03
IGL02343:Lrriq1	APN	10	103234163	splice site	probably benign
IGL02408:Lrriq1	APN	10	103146281	missense	probably benign	0.17
IGL02431:Lrriq1	APN	10	103200639	missense	probably damaging	1.00
IGL02540:Lrriq1	APN	10	103215019	missense	probably benign	0.02
IGL02558:Lrriq1	APN	10	103146283	missense	probably damaging	1.00
IGL02613:Lrriq1	APN	10	103144548	missense	probably damaging	0.99
IGL02642:Lrriq1	APN	10	103221461	critical splice acceptor site	probably null
IGL03027:Lrriq1	APN	10	103227196	missense	probably benign	0.35
PIT4362001:Lrriq1	UTSW	10	103071194	missense	probably benign	0.26
R0050:Lrriq1	UTSW	10	103068931	missense	probably damaging	0.99
R0050:Lrriq1	UTSW	10	103068931	missense	probably damaging	0.99
R0068:Lrriq1	UTSW	10	103063418	missense	probably benign	0.02
R0068:Lrriq1	UTSW	10	103063418	missense	probably benign	0.02
R0124:Lrriq1	UTSW	10	103170420	critical splice donor site	probably null
R0244:Lrriq1	UTSW	10	103215773	missense	probably damaging	0.98
R0323:Lrriq1	UTSW	10	103221289	missense	possibly damaging	0.91
R0515:Lrriq1	UTSW	10	103068968	splice site	probably null
R0522:Lrriq1	UTSW	10	103161777	missense	probably damaging	0.99
R0701:Lrriq1	UTSW	10	103234044	missense	probably benign
R1220:Lrriq1	UTSW	10	103071129	missense	probably benign	0.05
R1261:Lrriq1	UTSW	10	103234137	missense	possibly damaging	0.87
R1262:Lrriq1	UTSW	10	103234137	missense	possibly damaging	0.87
R1451:Lrriq1	UTSW	10	103202515	splice site	probably benign
R1642:Lrriq1	UTSW	10	103214456	missense	probably benign	0.13
R1643:Lrriq1	UTSW	10	103214824	missense	probably benign	0.00
R1647:Lrriq1	UTSW	10	103170648	nonsense	probably null
R1830:Lrriq1	UTSW	10	103161759	missense	probably benign
R1843:Lrriq1	UTSW	10	103227173	splice site	probably null
R2128:Lrriq1	UTSW	10	103214857	missense	probably benign	0.01
R2129:Lrriq1	UTSW	10	103214857	missense	probably benign	0.01
R2199:Lrriq1	UTSW	10	103068913	missense	probably damaging	1.00
R2354:Lrriq1	UTSW	10	103189987	missense	probably damaging	1.00
R2495:Lrriq1	UTSW	10	103202381	missense	probably damaging	0.97
R2897:Lrriq1	UTSW	10	103227250	missense	probably damaging	0.99
R2898:Lrriq1	UTSW	10	103227250	missense	probably damaging	0.99
R2922:Lrriq1	UTSW	10	103214675	missense	probably benign	0.00
R2939:Lrriq1	UTSW	10	103144889	missense	probably damaging	0.98
R2965:Lrriq1	UTSW	10	103214900	missense	probably benign	0.07
R2966:Lrriq1	UTSW	10	103214900	missense	probably benign	0.07
R3081:Lrriq1	UTSW	10	103144889	missense	probably damaging	0.98
R3115:Lrriq1	UTSW	10	103170433	missense	probably benign	0.00
R3745:Lrriq1	UTSW	10	103170856	missense	probably damaging	0.99
R3813:Lrriq1	UTSW	10	103216111	missense	probably damaging	1.00
R3814:Lrriq1	UTSW	10	103216111	missense	probably damaging	1.00
R3885:Lrriq1	UTSW	10	103216106	missense	probably damaging	0.96
R4378:Lrriq1	UTSW	10	103202364	missense	probably damaging	1.00
R4632:Lrriq1	UTSW	10	103221427	missense	probably damaging	1.00
R4633:Lrriq1	UTSW	10	103200563	nonsense	probably null
R4663:Lrriq1	UTSW	10	103063412	missense	possibly damaging	0.88
R4702:Lrriq1	UTSW	10	103215749	missense	possibly damaging	0.65
R4793:Lrriq1	UTSW	10	103170466	missense	probably benign	0.25
R4801:Lrriq1	UTSW	10	103221318	missense	probably benign	0.02
R4802:Lrriq1	UTSW	10	103221318	missense	probably benign	0.02
R4815:Lrriq1	UTSW	10	103144878	missense	probably benign	0.10
R4872:Lrriq1	UTSW	10	103178788	missense	possibly damaging	0.56
R4877:Lrriq1	UTSW	10	103234038	missense	possibly damaging	0.88
R4894:Lrriq1	UTSW	10	103161752	missense	possibly damaging	0.86
R4990:Lrriq1	UTSW	10	103200559	missense	probably damaging	1.00
R4991:Lrriq1	UTSW	10	103200559	missense	probably damaging	1.00
R5011:Lrriq1	UTSW	10	103189923	missense	probably damaging	1.00
R5013:Lrriq1	UTSW	10	103189923	missense	probably damaging	1.00
R5122:Lrriq1	UTSW	10	103187453	missense	probably damaging	1.00
R5282:Lrriq1	UTSW	10	103215345	missense	probably benign	0.01
R5311:Lrriq1	UTSW	10	103214587	missense	probably damaging	1.00
R5567:Lrriq1	UTSW	10	103170596	missense	possibly damaging	0.56
R5643:Lrriq1	UTSW	10	103215440	missense	probably benign	0.00
R5683:Lrriq1	UTSW	10	103173375	missense	probably damaging	1.00
R5916:Lrriq1	UTSW	10	103221382	nonsense	probably null
R6008:Lrriq1	UTSW	10	103170464	missense	probably damaging	1.00
R6022:Lrriq1	UTSW	10	103215534	missense	possibly damaging	0.90
R6224:Lrriq1	UTSW	10	103215757	missense	probably damaging	1.00
R6254:Lrriq1	UTSW	10	103215451	missense	probably benign	0.15
R6311:Lrriq1	UTSW	10	103173393	missense	probably benign	0.03
R6460:Lrriq1	UTSW	10	103200698	missense	probably damaging	1.00
R6502:Lrriq1	UTSW	10	103227184	missense	probably damaging	0.99
R6637:Lrriq1	UTSW	10	103221432	missense	probably benign	0.06
R6736:Lrriq1	UTSW	10	103181889	critical splice acceptor site	probably null
R6928:Lrriq1	UTSW	10	103214939	missense	possibly damaging	0.95
R6991:Lrriq1	UTSW	10	103187458	missense	probably damaging	1.00
R7174:Lrriq1	UTSW	10	103224965	missense	probably benign
R7241:Lrriq1	UTSW	10	103215973	missense	probably damaging	1.00
R7248:Lrriq1	UTSW	10	103223750	missense	possibly damaging	0.85
R7287:Lrriq1	UTSW	10	103216016	missense	probably benign	0.00
R7402:Lrriq1	UTSW	10	103221324	missense	possibly damaging	0.87
R7439:Lrriq1	UTSW	10	103214519	missense	probably benign	0.21
R7585:Lrriq1	UTSW	10	103214946	missense	possibly damaging	0.93
R7611:Lrriq1	UTSW	10	103200571	missense	possibly damaging	0.54
R7634:Lrriq1	UTSW	10	103200601	missense	probably damaging	1.00
R7767:Lrriq1	UTSW	10	103215954	missense	probably damaging	0.99
R7809:Lrriq1	UTSW	10	103215817	missense	probably damaging	0.99
R7910:Lrriq1	UTSW	10	103215194	nonsense	probably null
R8131:Lrriq1	UTSW	10	103215711	missense	possibly damaging	0.57
R8156:Lrriq1	UTSW	10	103156335	critical splice donor site	probably null
R8211:Lrriq1	UTSW	10	103170547	missense	probably damaging	1.00
R8304:Lrriq1	UTSW	10	103234068	missense	possibly damaging	0.57
R8487:Lrriq1	UTSW	10	103215053	missense	probably damaging	0.98
R8500:Lrriq1	UTSW	10	103046155	missense
R9013:Lrriq1	UTSW	10	103215070	missense	probably damaging	1.00
R9099:Lrriq1	UTSW	10	103216003	missense	probably damaging	0.98
R9155:Lrriq1	UTSW	10	103214779	missense	probably benign	0.03
R9320:Lrriq1	UTSW	10	103221283	missense	probably benign
R9384:Lrriq1	UTSW	10	103170597	missense	probably benign	0.00
R9469:Lrriq1	UTSW	10	103214900	missense	probably benign	0.07
R9585:Lrriq1	UTSW	10	103215389	missense	probably benign
R9706:Lrriq1	UTSW	10	103046041	missense
R9780:Lrriq1	UTSW	10	103189963	missense	probably damaging	1.00
X0026:Lrriq1	UTSW	10	103215704	nonsense	probably null
Z1088:Lrriq1	UTSW	10	103202446	missense	probably damaging	1.00
Z1176:Lrriq1	UTSW	10	103202359	missense	probably damaging	1.00
Z1176:Lrriq1	UTSW	10	103202360	missense	probably damaging	1.00
Z1176:Lrriq1	UTSW	10	103234085	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- CTCTGTAGGAAAGCCTCTGG -3'
(R):5'- GGACATTATTTCCTCACCATGC -3'

Sequencing Primer
(F):5'- CCTCTGGCGATATGATGTATTGGC -3'
(R):5'- ACCATGCCTTAATCAGTATATTGCC -3'

Posted On

2018-08-01