Incidental Mutation 'R6719:Kat2a'
ID529502
Institutional Source Beutler Lab
Gene Symbol Kat2a
Ensembl Gene ENSMUSG00000020918
Gene NameK(lysine) acetyltransferase 2A
SynonymsGcn5, PCAF-B/GCN5, 1110051E14Rik, Gcn5l2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6719 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location100704746-100712465 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 100712141 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Histidine at position 88 (Q88H)
Ref Sequence ENSEMBL: ENSMUSP00000099407 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006973] [ENSMUST00000017976] [ENSMUST00000019317] [ENSMUST00000103118] [ENSMUST00000107364] [ENSMUST00000169833]
Predicted Effect probably benign
Transcript: ENSMUST00000006973
AA Change: Q88H

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000006973
Gene: ENSMUSG00000020918
AA Change: Q88H

DomainStartEndE-ValueType
low complexity region 21 72 N/A INTRINSIC
Pfam:PCAF_N 81 332 1.2e-155 PFAM
low complexity region 398 417 N/A INTRINSIC
Pfam:Acetyltransf_7 538 621 5e-13 PFAM
Pfam:Acetyltransf_1 545 620 3.2e-11 PFAM
low complexity region 659 675 N/A INTRINSIC
BROMO 718 826 6.87e-38 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000017976
SMART Domains Protein: ENSMUSP00000017976
Gene: ENSMUSG00000017832

DomainStartEndE-ValueType
Pfam:HSP20 52 149 4.7e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000019317
SMART Domains Protein: ENSMUSP00000019317
Gene: ENSMUSG00000019173

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
RAB 22 203 6.29e-85 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000103118
AA Change: Q88H

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000099407
Gene: ENSMUSG00000020918
AA Change: Q88H

DomainStartEndE-ValueType
low complexity region 21 72 N/A INTRINSIC
Pfam:PCAF_N 81 331 4.4e-120 PFAM
low complexity region 398 417 N/A INTRINSIC
Pfam:Acetyltransf_7 539 622 1.2e-11 PFAM
Pfam:Acetyltransf_1 547 621 3.1e-11 PFAM
low complexity region 660 676 N/A INTRINSIC
BROMO 719 827 6.87e-38 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107364
SMART Domains Protein: ENSMUSP00000102987
Gene: ENSMUSG00000019173

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
RAB 22 185 3.37e-94 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126299
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153526
Predicted Effect probably benign
Transcript: ENSMUST00000169833
SMART Domains Protein: ENSMUSP00000130551
Gene: ENSMUSG00000017832

DomainStartEndE-ValueType
Pfam:HSP20 83 178 1.2e-13 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] KAT2A, or GCN5, is a histone acetyltransferase (HAT) that functions primarily as a transcriptional activator. It also functions as a repressor of NF-kappa-B (see MIM 164011) by promoting ubiquitination of the NF-kappa-B subunit RELA (MIM 164014) in a HAT-independent manner (Mao et al., 2009 [PubMed 19339690]).[supplied by OMIM, Sep 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit poorly developed yolk sac blood vessels, retarded growth, absence of dorsal mesoderm lineages, failure to form somites, and lethality between embryonic days 9.5-11.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933411K16Rik T C 19: 42,052,712 I94T possibly damaging Het
Afp T A 5: 90,503,703 N392K probably benign Het
Asrgl1 C T 19: 9,113,148 G278D probably damaging Het
Atp2c1 T C 9: 105,424,178 I611V probably damaging Het
Avl9 A G 6: 56,753,385 Y571C probably damaging Het
Clrn1 A T 3: 58,846,440 C167S probably damaging Het
Ctsr C T 13: 61,160,451 G293D possibly damaging Het
Dmbt1 T A 7: 131,119,603 S1867T possibly damaging Het
Dock9 A T 14: 121,610,027 I1025N probably damaging Het
Dppa4 G A 16: 48,287,884 A11T probably damaging Het
Duox2 T A 2: 122,284,386 probably null Het
Fat3 A G 9: 15,996,144 L2854P probably benign Het
Fcer1a A G 1: 173,222,773 S61P possibly damaging Het
Fyb2 A T 4: 105,010,459 D669V probably benign Het
Herc2 G T 7: 56,212,826 C4081F probably damaging Het
Hexim1 T C 11: 103,117,265 L115P probably benign Het
Lrriq1 T C 10: 103,071,116 Y1581C probably damaging Het
Ltbp4 T G 7: 27,328,763 D323A probably damaging Het
Mark3 T A 12: 111,615,442 I115K probably damaging Het
Nudt9 A G 5: 104,061,696 D271G probably damaging Het
Olfr441 T A 6: 43,115,973 V77D probably damaging Het
Parvb C T 15: 84,297,979 R237W probably damaging Het
Pcdha5 T C 18: 36,960,872 S145P probably damaging Het
Pzp T C 6: 128,524,083 E104G probably benign Het
Rho T C 6: 115,933,893 I133T possibly damaging Het
Sall3 G T 18: 80,971,506 T997K probably damaging Het
Scn8a A T 15: 101,011,015 probably null Het
Sfxn1 T A 13: 54,106,564 H310Q probably benign Het
Slc25a18 A G 6: 120,788,254 D92G probably damaging Het
Slc26a9 T C 1: 131,761,785 I490T probably benign Het
Terf1 T C 1: 15,838,236 V351A probably benign Het
Thsd7b A G 1: 130,159,714 probably null Het
Trgj2 A G 13: 19,311,256 probably benign Het
Tti1 A T 2: 157,982,300 C1078S probably benign Het
Ttll3 A G 6: 113,399,032 probably benign Het
Tubb1 A C 2: 174,457,394 T290P probably damaging Het
Ugt2b35 G T 5: 87,007,388 D361Y probably damaging Het
Zc2hc1c T C 12: 85,290,672 S368P probably damaging Het
Other mutations in Kat2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00470:Kat2a APN 11 100705384 missense probably damaging 1.00
IGL00476:Kat2a APN 11 100705384 missense probably damaging 1.00
IGL00952:Kat2a APN 11 100706151 missense probably damaging 0.98
IGL01529:Kat2a APN 11 100711909 missense probably damaging 1.00
IGL02424:Kat2a APN 11 100711147 unclassified probably null
IGL03338:Kat2a APN 11 100711475 missense probably benign 0.30
R0096:Kat2a UTSW 11 100706471 missense probably damaging 1.00
R0711:Kat2a UTSW 11 100706471 missense probably damaging 1.00
R0714:Kat2a UTSW 11 100711352 missense probably damaging 0.99
R0784:Kat2a UTSW 11 100710841 missense probably benign 0.05
R1652:Kat2a UTSW 11 100708611 missense probably damaging 0.98
R2152:Kat2a UTSW 11 100712346 unclassified probably benign
R2177:Kat2a UTSW 11 100710822 missense probably damaging 1.00
R2510:Kat2a UTSW 11 100712142 missense probably benign 0.32
R2570:Kat2a UTSW 11 100710822 missense probably damaging 1.00
R4175:Kat2a UTSW 11 100705266 missense probably damaging 1.00
R4965:Kat2a UTSW 11 100712203 unclassified probably benign
R4965:Kat2a UTSW 11 100712204 unclassified probably benign
R5316:Kat2a UTSW 11 100712170 missense possibly damaging 0.77
R5732:Kat2a UTSW 11 100708240 missense probably damaging 1.00
R5954:Kat2a UTSW 11 100708898 missense possibly damaging 0.89
R6618:Kat2a UTSW 11 100712370 unclassified probably benign
R6731:Kat2a UTSW 11 100708273 missense probably damaging 0.98
R7291:Kat2a UTSW 11 100710900 missense possibly damaging 0.55
R7373:Kat2a UTSW 11 100708566 missense probably benign 0.00
R7632:Kat2a UTSW 11 100708596 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CAGTTCCCTGATGCTGTCTG -3'
(R):5'- GGCAAAGGAAGACTACGACTCC -3'

Sequencing Primer
(F):5'- TGTCTGCATCCCAAGCG -3'
(R):5'- ATGGCGGAACCTTCCCAG -3'
Posted On2018-08-01