Incidental Mutation 'R6719:Zc2hc1c'
ID529504
Institutional Source Beutler Lab
Gene Symbol Zc2hc1c
Ensembl Gene ENSMUSG00000045064
Gene Namezinc finger, C2HC-type containing 1C
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock #R6719 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location85288591-85299358 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 85290672 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 368 (S368P)
Ref Sequence ENSEMBL: ENSMUSP00000051664 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059341] [ENSMUST00000121930]
Predicted Effect probably damaging
Transcript: ENSMUST00000059341
AA Change: S368P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000051664
Gene: ENSMUSG00000045064
AA Change: S368P

DomainStartEndE-ValueType
low complexity region 93 106 N/A INTRINSIC
coiled coil region 207 254 N/A INTRINSIC
Pfam:zf-C2HC_2 378 402 3.6e-10 PFAM
low complexity region 433 444 N/A INTRINSIC
Pfam:zf-C2HC_2 489 513 3.1e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121930
SMART Domains Protein: ENSMUSP00000112609
Gene: ENSMUSG00000008822

DomainStartEndE-ValueType
Pfam:Acylphosphatase 64 156 4.5e-25 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933411K16Rik T C 19: 42,052,712 I94T possibly damaging Het
Afp T A 5: 90,503,703 N392K probably benign Het
Asrgl1 C T 19: 9,113,148 G278D probably damaging Het
Atp2c1 T C 9: 105,424,178 I611V probably damaging Het
Avl9 A G 6: 56,753,385 Y571C probably damaging Het
Clrn1 A T 3: 58,846,440 C167S probably damaging Het
Ctsr C T 13: 61,160,451 G293D possibly damaging Het
Dmbt1 T A 7: 131,119,603 S1867T possibly damaging Het
Dock9 A T 14: 121,610,027 I1025N probably damaging Het
Dppa4 G A 16: 48,287,884 A11T probably damaging Het
Duox2 T A 2: 122,284,386 probably null Het
Fat3 A G 9: 15,996,144 L2854P probably benign Het
Fcer1a A G 1: 173,222,773 S61P possibly damaging Het
Fyb2 A T 4: 105,010,459 D669V probably benign Het
Herc2 G T 7: 56,212,826 C4081F probably damaging Het
Hexim1 T C 11: 103,117,265 L115P probably benign Het
Kat2a T G 11: 100,712,141 Q88H probably benign Het
Lrriq1 T C 10: 103,071,116 Y1581C probably damaging Het
Ltbp4 T G 7: 27,328,763 D323A probably damaging Het
Mark3 T A 12: 111,615,442 I115K probably damaging Het
Nudt9 A G 5: 104,061,696 D271G probably damaging Het
Olfr441 T A 6: 43,115,973 V77D probably damaging Het
Parvb C T 15: 84,297,979 R237W probably damaging Het
Pcdha5 T C 18: 36,960,872 S145P probably damaging Het
Pzp T C 6: 128,524,083 E104G probably benign Het
Rho T C 6: 115,933,893 I133T possibly damaging Het
Sall3 G T 18: 80,971,506 T997K probably damaging Het
Scn8a A T 15: 101,011,015 probably null Het
Sfxn1 T A 13: 54,106,564 H310Q probably benign Het
Slc25a18 A G 6: 120,788,254 D92G probably damaging Het
Slc26a9 T C 1: 131,761,785 I490T probably benign Het
Terf1 T C 1: 15,838,236 V351A probably benign Het
Thsd7b A G 1: 130,159,714 probably null Het
Trgj2 A G 13: 19,311,256 probably benign Het
Tti1 A T 2: 157,982,300 C1078S probably benign Het
Ttll3 A G 6: 113,399,032 probably benign Het
Tubb1 A C 2: 174,457,394 T290P probably damaging Het
Ugt2b35 G T 5: 87,007,388 D361Y probably damaging Het
Other mutations in Zc2hc1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01763:Zc2hc1c APN 12 85289676 missense probably benign 0.03
IGL02677:Zc2hc1c APN 12 85290076 missense probably benign 0.31
R1053:Zc2hc1c UTSW 12 85296556 missense probably damaging 1.00
R1696:Zc2hc1c UTSW 12 85290781 missense possibly damaging 0.86
R1724:Zc2hc1c UTSW 12 85289812 missense probably benign 0.00
R1905:Zc2hc1c UTSW 12 85290514 missense probably benign 0.03
R1996:Zc2hc1c UTSW 12 85296660 missense probably benign 0.31
R4463:Zc2hc1c UTSW 12 85290297 missense probably damaging 0.97
R4834:Zc2hc1c UTSW 12 85290208 missense probably damaging 1.00
R5070:Zc2hc1c UTSW 12 85290514 missense probably benign 0.03
R5943:Zc2hc1c UTSW 12 85289709 missense probably damaging 1.00
R6184:Zc2hc1c UTSW 12 85296444 missense probably damaging 0.96
R6701:Zc2hc1c UTSW 12 85289672 unclassified probably null
R6704:Zc2hc1c UTSW 12 85290484 missense possibly damaging 0.84
R7665:Zc2hc1c UTSW 12 85296562 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- TCAAACTTGTGATCAGGCTCAGG -3'
(R):5'- CCCTCCAGTTCAAGTACTGC -3'

Sequencing Primer
(F):5'- CTTGTGATCAGGCTCAGGAAAACC -3'
(R):5'- AGTTCAAGTACTGCTCTAGTTCTG -3'
Posted On2018-08-01