Incidental Mutation 'R6719:Ctsr'
ID529508
Institutional Source Beutler Lab
Gene Symbol Ctsr
Ensembl Gene ENSMUSG00000055679
Gene Namecathepsin R
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R6719 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location61159204-61164256 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 61160451 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 293 (G293D)
Ref Sequence ENSEMBL: ENSMUSP00000021889 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021889]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021889
AA Change: G293D

PolyPhen 2 Score 0.598 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000021889
Gene: ENSMUSG00000055679
AA Change: G293D

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Inhibitor_I29 29 88 1.68e-21 SMART
Pept_C1 115 333 1.59e-111 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933411K16Rik T C 19: 42,052,712 I94T possibly damaging Het
Afp T A 5: 90,503,703 N392K probably benign Het
Asrgl1 C T 19: 9,113,148 G278D probably damaging Het
Atp2c1 T C 9: 105,424,178 I611V probably damaging Het
Avl9 A G 6: 56,753,385 Y571C probably damaging Het
Clrn1 A T 3: 58,846,440 C167S probably damaging Het
Dmbt1 T A 7: 131,119,603 S1867T possibly damaging Het
Dock9 A T 14: 121,610,027 I1025N probably damaging Het
Dppa4 G A 16: 48,287,884 A11T probably damaging Het
Duox2 T A 2: 122,284,386 probably null Het
Fat3 A G 9: 15,996,144 L2854P probably benign Het
Fcer1a A G 1: 173,222,773 S61P possibly damaging Het
Fyb2 A T 4: 105,010,459 D669V probably benign Het
Herc2 G T 7: 56,212,826 C4081F probably damaging Het
Hexim1 T C 11: 103,117,265 L115P probably benign Het
Kat2a T G 11: 100,712,141 Q88H probably benign Het
Lrriq1 T C 10: 103,071,116 Y1581C probably damaging Het
Ltbp4 T G 7: 27,328,763 D323A probably damaging Het
Mark3 T A 12: 111,615,442 I115K probably damaging Het
Nudt9 A G 5: 104,061,696 D271G probably damaging Het
Olfr441 T A 6: 43,115,973 V77D probably damaging Het
Parvb C T 15: 84,297,979 R237W probably damaging Het
Pcdha5 T C 18: 36,960,872 S145P probably damaging Het
Pzp T C 6: 128,524,083 E104G probably benign Het
Rho T C 6: 115,933,893 I133T possibly damaging Het
Sall3 G T 18: 80,971,506 T997K probably damaging Het
Scn8a A T 15: 101,011,015 probably null Het
Sfxn1 T A 13: 54,106,564 H310Q probably benign Het
Slc25a18 A G 6: 120,788,254 D92G probably damaging Het
Slc26a9 T C 1: 131,761,785 I490T probably benign Het
Terf1 T C 1: 15,838,236 V351A probably benign Het
Thsd7b A G 1: 130,159,714 probably null Het
Trgj2 A G 13: 19,311,256 probably benign Het
Tti1 A T 2: 157,982,300 C1078S probably benign Het
Ttll3 A G 6: 113,399,032 probably benign Het
Tubb1 A C 2: 174,457,394 T290P probably damaging Het
Ugt2b35 G T 5: 87,007,388 D361Y probably damaging Het
Zc2hc1c T C 12: 85,290,672 S368P probably damaging Het
Other mutations in Ctsr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00647:Ctsr APN 13 61162742 missense probably damaging 1.00
IGL01327:Ctsr APN 13 61162675 splice site probably benign
IGL02169:Ctsr APN 13 61163240 splice site probably benign
IGL02516:Ctsr APN 13 61163178 missense probably benign
IGL02739:Ctsr APN 13 61161844 missense probably benign 0.01
PIT4687001:Ctsr UTSW 13 61160532 missense possibly damaging 0.52
R0180:Ctsr UTSW 13 61162745 missense probably damaging 1.00
R1938:Ctsr UTSW 13 61162445 missense probably benign 0.00
R2362:Ctsr UTSW 13 61162796 missense probably damaging 1.00
R3856:Ctsr UTSW 13 61161936 missense possibly damaging 0.75
R4125:Ctsr UTSW 13 61161845 missense probably benign 0.17
R4135:Ctsr UTSW 13 61161270 missense probably benign 0.15
R4903:Ctsr UTSW 13 61163131 missense probably benign 0.01
R5551:Ctsr UTSW 13 61159543 missense probably damaging 1.00
R5705:Ctsr UTSW 13 61161264 missense probably damaging 1.00
R5721:Ctsr UTSW 13 61161853 missense possibly damaging 0.84
R6132:Ctsr UTSW 13 61161768 critical splice donor site probably null
R6196:Ctsr UTSW 13 61160531 missense probably benign 0.09
R7530:Ctsr UTSW 13 61163117 missense probably damaging 1.00
R7698:Ctsr UTSW 13 61162567 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ATGTATACATACTTCCCACGTGTAC -3'
(R):5'- GCCTCCTTTGAAAACTGTTGGTG -3'

Sequencing Primer
(F):5'- cccctgaaatgttaggca -3'
(R):5'- TGTTGGTGACAGAACTCACTG -3'
Posted On2018-08-01