Incidental Mutation 'R6719:Parvb'
ID529510
Institutional Source Beutler Lab
Gene Symbol Parvb
Ensembl Gene ENSMUSG00000022438
Gene Nameparvin, beta
Synonymsaffixin, D15Gsk1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6719 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location84232043-84315688 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 84297979 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 237 (R237W)
Ref Sequence ENSEMBL: ENSMUSP00000023072 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023072]
Predicted Effect probably damaging
Transcript: ENSMUST00000023072
AA Change: R237W

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000023072
Gene: ENSMUSG00000022438
AA Change: R237W

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
CH 90 190 3.46e-1 SMART
low complexity region 204 211 N/A INTRINSIC
CH 257 360 9.18e-2 SMART
Meta Mutation Damage Score 0.2669 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the parvin family of actin-binding proteins, which play a role in cytoskeleton organization and cell adhesion. These proteins are associated with focal contacts and contain calponin homology domains that bind to actin filaments. This family member binds to alphaPIX and alpha-actinin, and it can inhibit the activity of integrin-linked kinase. This protein also functions in tumor suppression. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Aug 2011]
PHENOTYPE: Disruption of this marker has no apparent adverse consequences. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933411K16Rik T C 19: 42,052,712 I94T possibly damaging Het
Afp T A 5: 90,503,703 N392K probably benign Het
Asrgl1 C T 19: 9,113,148 G278D probably damaging Het
Atp2c1 T C 9: 105,424,178 I611V probably damaging Het
Avl9 A G 6: 56,753,385 Y571C probably damaging Het
Clrn1 A T 3: 58,846,440 C167S probably damaging Het
Ctsr C T 13: 61,160,451 G293D possibly damaging Het
Dmbt1 T A 7: 131,119,603 S1867T possibly damaging Het
Dock9 A T 14: 121,610,027 I1025N probably damaging Het
Dppa4 G A 16: 48,287,884 A11T probably damaging Het
Duox2 T A 2: 122,284,386 probably null Het
Fat3 A G 9: 15,996,144 L2854P probably benign Het
Fcer1a A G 1: 173,222,773 S61P possibly damaging Het
Fyb2 A T 4: 105,010,459 D669V probably benign Het
Herc2 G T 7: 56,212,826 C4081F probably damaging Het
Hexim1 T C 11: 103,117,265 L115P probably benign Het
Kat2a T G 11: 100,712,141 Q88H probably benign Het
Lrriq1 T C 10: 103,071,116 Y1581C probably damaging Het
Ltbp4 T G 7: 27,328,763 D323A probably damaging Het
Mark3 T A 12: 111,615,442 I115K probably damaging Het
Nudt9 A G 5: 104,061,696 D271G probably damaging Het
Olfr441 T A 6: 43,115,973 V77D probably damaging Het
Pcdha5 T C 18: 36,960,872 S145P probably damaging Het
Pzp T C 6: 128,524,083 E104G probably benign Het
Rho T C 6: 115,933,893 I133T possibly damaging Het
Sall3 G T 18: 80,971,506 T997K probably damaging Het
Scn8a A T 15: 101,011,015 probably null Het
Sfxn1 T A 13: 54,106,564 H310Q probably benign Het
Slc25a18 A G 6: 120,788,254 D92G probably damaging Het
Slc26a9 T C 1: 131,761,785 I490T probably benign Het
Terf1 T C 1: 15,838,236 V351A probably benign Het
Thsd7b A G 1: 130,159,714 probably null Het
Trgj2 A G 13: 19,311,256 probably benign Het
Tti1 A T 2: 157,982,300 C1078S probably benign Het
Ttll3 A G 6: 113,399,032 probably benign Het
Tubb1 A C 2: 174,457,394 T290P probably damaging Het
Ugt2b35 G T 5: 87,007,388 D361Y probably damaging Het
Zc2hc1c T C 12: 85,290,672 S368P probably damaging Het
Other mutations in Parvb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01610:Parvb APN 15 84303465 missense probably damaging 1.00
IGL02415:Parvb APN 15 84292815 missense probably damaging 1.00
IGL02458:Parvb APN 15 84303434 missense probably damaging 1.00
IGL02937:Parvb APN 15 84308953 missense probably damaging 1.00
IGL03088:Parvb APN 15 84308843 splice site probably benign
R0422:Parvb UTSW 15 84295611 missense probably benign 0.28
R1470:Parvb UTSW 15 84271252 missense probably damaging 1.00
R1470:Parvb UTSW 15 84271308 missense probably benign 0.00
R1470:Parvb UTSW 15 84271252 missense probably damaging 1.00
R1470:Parvb UTSW 15 84271308 missense probably benign 0.00
R1713:Parvb UTSW 15 84297991 splice site probably benign
R2031:Parvb UTSW 15 84282835 missense probably benign 0.09
R2146:Parvb UTSW 15 84232168 missense possibly damaging 0.63
R2148:Parvb UTSW 15 84232168 missense possibly damaging 0.63
R2149:Parvb UTSW 15 84232168 missense possibly damaging 0.63
R2150:Parvb UTSW 15 84232168 missense possibly damaging 0.63
R2508:Parvb UTSW 15 84297970 missense probably benign
R4770:Parvb UTSW 15 84303905 critical splice donor site probably null
R5948:Parvb UTSW 15 84303461 missense probably damaging 1.00
R6492:Parvb UTSW 15 84303872 missense probably damaging 1.00
R6718:Parvb UTSW 15 84297979 missense probably damaging 0.96
R6720:Parvb UTSW 15 84297979 missense probably damaging 0.96
R6722:Parvb UTSW 15 84297979 missense probably damaging 0.96
R7189:Parvb UTSW 15 84303471 critical splice donor site probably null
R7285:Parvb UTSW 15 84282784 missense possibly damaging 0.94
R7492:Parvb UTSW 15 84290450 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACGATGCAAATGATGTCCTCTC -3'
(R):5'- AGAGATGTTCTCCAGGCTGG -3'

Sequencing Primer
(F):5'- TGTCCTCTCTAAATGATACACCAGGG -3'
(R):5'- GGCCCCTCTGTCCCTACAAG -3'
Posted On2018-08-01