Incidental Mutation 'R6719:Dppa4'
ID529512
Institutional Source Beutler Lab
Gene Symbol Dppa4
Ensembl Gene ENSMUSG00000058550
Gene Namedevelopmental pluripotency associated 4
Synonyms2410091M23Rik, ECAT15-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6719 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location48283733-48294237 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 48287884 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 11 (A11T)
Ref Sequence ENSEMBL: ENSMUSP00000093749 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050705] [ENSMUST00000096045]
Predicted Effect probably damaging
Transcript: ENSMUST00000050705
AA Change: A11T

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000093748
Gene: ENSMUSG00000058550
AA Change: A11T

DomainStartEndE-ValueType
low complexity region 23 43 N/A INTRINSIC
low complexity region 125 142 N/A INTRINSIC
Pfam:DCR 169 236 1.2e-39 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000096045
AA Change: A11T

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000093749
Gene: ENSMUSG00000058550
AA Change: A11T

DomainStartEndE-ValueType
low complexity region 23 43 N/A INTRINSIC
low complexity region 70 80 N/A INTRINSIC
Blast:SAP 81 115 3e-9 BLAST
Pfam:Dppa2_A 123 158 1.2e-3 PFAM
Pfam:Dppa2_A 173 219 1.1e-9 PFAM
Pfam:DCR 221 287 1.5e-41 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231359
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear factor that is involved in the maintenance of pluripotency in stem cells and essential for embryogenesis. The encoded protein has a scaffold-attachment factor A/B, acinus and PIAS (SAP) domain that binds DNA and is thought to modify chromatin. Mice with a homozygous knockout of the orthologous gene die during late embryonic development or within hours after birth. Knockout embryos are normal in size at embryonic day 18.5 but exhibit skeletal and lung tissue abnormalities. This gene, when mutated, is highly expressed in embryonal carcinomas, pluripotent germ cell tumors, and other cancers and is thought to play an important role in tumor progression. Multiple pseudogenes of this gene have been identified. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit perinatal and postnatal lethality, abnormal lung morphology, skeletal defects, and a maternal effect on female fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933411K16Rik T C 19: 42,052,712 I94T possibly damaging Het
Afp T A 5: 90,503,703 N392K probably benign Het
Asrgl1 C T 19: 9,113,148 G278D probably damaging Het
Atp2c1 T C 9: 105,424,178 I611V probably damaging Het
Avl9 A G 6: 56,753,385 Y571C probably damaging Het
Clrn1 A T 3: 58,846,440 C167S probably damaging Het
Ctsr C T 13: 61,160,451 G293D possibly damaging Het
Dmbt1 T A 7: 131,119,603 S1867T possibly damaging Het
Dock9 A T 14: 121,610,027 I1025N probably damaging Het
Duox2 T A 2: 122,284,386 probably null Het
Fat3 A G 9: 15,996,144 L2854P probably benign Het
Fcer1a A G 1: 173,222,773 S61P possibly damaging Het
Fyb2 A T 4: 105,010,459 D669V probably benign Het
Herc2 G T 7: 56,212,826 C4081F probably damaging Het
Hexim1 T C 11: 103,117,265 L115P probably benign Het
Kat2a T G 11: 100,712,141 Q88H probably benign Het
Lrriq1 T C 10: 103,071,116 Y1581C probably damaging Het
Ltbp4 T G 7: 27,328,763 D323A probably damaging Het
Mark3 T A 12: 111,615,442 I115K probably damaging Het
Nudt9 A G 5: 104,061,696 D271G probably damaging Het
Olfr441 T A 6: 43,115,973 V77D probably damaging Het
Parvb C T 15: 84,297,979 R237W probably damaging Het
Pcdha5 T C 18: 36,960,872 S145P probably damaging Het
Pzp T C 6: 128,524,083 E104G probably benign Het
Rho T C 6: 115,933,893 I133T possibly damaging Het
Sall3 G T 18: 80,971,506 T997K probably damaging Het
Scn8a A T 15: 101,011,015 probably null Het
Sfxn1 T A 13: 54,106,564 H310Q probably benign Het
Slc25a18 A G 6: 120,788,254 D92G probably damaging Het
Slc26a9 T C 1: 131,761,785 I490T probably benign Het
Terf1 T C 1: 15,838,236 V351A probably benign Het
Thsd7b A G 1: 130,159,714 probably null Het
Trgj2 A G 13: 19,311,256 probably benign Het
Tti1 A T 2: 157,982,300 C1078S probably benign Het
Ttll3 A G 6: 113,399,032 probably benign Het
Tubb1 A C 2: 174,457,394 T290P probably damaging Het
Ugt2b35 G T 5: 87,007,388 D361Y probably damaging Het
Zc2hc1c T C 12: 85,290,672 S368P probably damaging Het
Other mutations in Dppa4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Dppa4 APN 16 48291083 missense possibly damaging 0.78
IGL02527:Dppa4 APN 16 48289093 missense possibly damaging 0.93
R0138:Dppa4 UTSW 16 48291062 missense probably benign 0.25
R0346:Dppa4 UTSW 16 48289324 splice site probably benign
R1216:Dppa4 UTSW 16 48292980 missense possibly damaging 0.91
R1453:Dppa4 UTSW 16 48291233 missense probably damaging 1.00
R1852:Dppa4 UTSW 16 48287884 missense probably damaging 0.99
R4452:Dppa4 UTSW 16 48289336 missense probably benign 0.38
R5133:Dppa4 UTSW 16 48292971 missense probably benign 0.18
R5616:Dppa4 UTSW 16 48291030 missense probably damaging 1.00
R5665:Dppa4 UTSW 16 48291015 missense probably benign
R5947:Dppa4 UTSW 16 48291108 missense possibly damaging 0.78
R5993:Dppa4 UTSW 16 48289346 nonsense probably null
R6018:Dppa4 UTSW 16 48289127 nonsense probably null
R6701:Dppa4 UTSW 16 48291311 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCTTTCCAATTTTATGACTCAGGTTGG -3'
(R):5'- CTGGCTAAACCTCAGATGAAGTACAG -3'

Sequencing Primer
(F):5'- ACTCAGGTTGGTTATTCAGATGATGC -3'
(R):5'- AAATTACTCTTGTCTCAACACCG -3'
Posted On2018-08-01