Incidental Mutation 'R6720:Pard3b'
ID 529517
Institutional Source Beutler Lab
Gene Symbol Pard3b
Ensembl Gene ENSMUSG00000052062
Gene Name par-3 family cell polarity regulator beta
Synonyms PAR3L, PAR3B, 1810008K04Rik, 2010002N16Rik, PAR3beta, Als2cr19, 2810455B10Rik
MMRRC Submission 044838-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6720 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 61677983-62681443 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 62198629 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Isoleucine at position 239 (N239I)
Ref Sequence ENSEMBL: ENSMUSP00000092510 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046673] [ENSMUST00000075374] [ENSMUST00000094906]
AlphaFold Q9CSB4
Predicted Effect possibly damaging
Transcript: ENSMUST00000046673
AA Change: N239I

PolyPhen 2 Score 0.547 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000040439
Gene: ENSMUSG00000052062
AA Change: N239I

DomainStartEndE-ValueType
Pfam:DUF3534 1 143 1.2e-66 PFAM
PDZ 211 291 1.5e-4 SMART
low complexity region 376 388 N/A INTRINSIC
PDZ 391 470 2.5e-24 SMART
internal_repeat_1 479 515 4.63e-5 PROSPERO
low complexity region 527 537 N/A INTRINSIC
low complexity region 594 601 N/A INTRINSIC
low complexity region 677 688 N/A INTRINSIC
coiled coil region 761 808 N/A INTRINSIC
coiled coil region 839 866 N/A INTRINSIC
low complexity region 1075 1083 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000075374
AA Change: N239I

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000074837
Gene: ENSMUSG00000052062
AA Change: N239I

DomainStartEndE-ValueType
Pfam:DUF3534 1 143 8.2e-66 PFAM
PDZ 211 291 1.5e-4 SMART
low complexity region 376 388 N/A INTRINSIC
PDZ 391 470 2.5e-24 SMART
low complexity region 487 498 N/A INTRINSIC
PDZ 507 592 6.17e-15 SMART
low complexity region 656 663 N/A INTRINSIC
low complexity region 739 750 N/A INTRINSIC
coiled coil region 823 870 N/A INTRINSIC
coiled coil region 901 928 N/A INTRINSIC
low complexity region 1137 1145 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000094906
AA Change: N239I

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000092510
Gene: ENSMUSG00000052062
AA Change: N239I

DomainStartEndE-ValueType
Pfam:DUF3534 1 143 1.1e-66 PFAM
PDZ 211 291 1.5e-4 SMART
low complexity region 376 388 N/A INTRINSIC
PDZ 391 470 2.5e-24 SMART
low complexity region 487 498 N/A INTRINSIC
PDZ 507 592 6.17e-15 SMART
low complexity region 656 663 N/A INTRINSIC
low complexity region 739 750 N/A INTRINSIC
coiled coil region 823 870 N/A INTRINSIC
low complexity region 901 913 N/A INTRINSIC
low complexity region 1038 1046 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188325
Meta Mutation Damage Score 0.3690 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.6%
Validation Efficiency 98% (50/51)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik G A 4: 137,181,997 (GRCm39) E51K possibly damaging Het
Abca1 A C 4: 53,083,733 (GRCm39) L700R probably damaging Het
Arpc1a C A 5: 145,038,032 (GRCm39) probably null Het
Baz2b G T 2: 59,755,234 (GRCm39) P241Q probably damaging Het
Cd6 T A 19: 10,771,973 (GRCm39) T414S probably benign Het
Ces2b A T 8: 105,563,501 (GRCm39) E409D probably benign Het
Cfap54 A G 10: 92,656,981 (GRCm39) Y3024H probably benign Het
Chrm1 A G 19: 8,655,912 (GRCm39) T206A probably benign Het
Clptm1l T C 13: 73,766,635 (GRCm39) W512R probably damaging Het
Col15a1 T A 4: 47,247,552 (GRCm39) probably null Het
Cox15 A G 19: 43,725,228 (GRCm39) S392P probably damaging Het
Cplx3 A G 9: 57,521,355 (GRCm39) probably null Het
Cr2 T C 1: 194,837,508 (GRCm39) M1197V probably damaging Het
Ddx60 A G 8: 62,453,723 (GRCm39) K1281E probably benign Het
Dnah11 A G 12: 118,009,381 (GRCm39) F2094L probably damaging Het
Ear2 T A 14: 44,340,416 (GRCm39) C25S probably damaging Het
Ect2l T C 10: 18,016,012 (GRCm39) D802G probably damaging Het
Eftud2 G A 11: 102,729,449 (GRCm39) Q84* probably null Het
Eif4g3 T A 4: 137,903,143 (GRCm39) probably null Het
Ephb2 T C 4: 136,384,813 (GRCm39) D866G probably damaging Het
Farsb A G 1: 78,449,134 (GRCm39) M99T probably damaging Het
Foxs1 T A 2: 152,774,640 (GRCm39) S138C probably damaging Het
Frem1 T G 4: 82,932,069 (GRCm39) S211R probably damaging Het
Gm19410 G A 8: 36,274,730 (GRCm39) R1517Q probably benign Het
Gria2 T C 3: 80,709,611 (GRCm39) I27M probably benign Het
H2-Q7 A G 17: 35,661,654 (GRCm39) E299G probably benign Het
Hao2 T G 3: 98,784,451 (GRCm39) I305L probably benign Het
Hectd4 C T 5: 121,445,444 (GRCm39) Q122* probably null Het
Hivep1 T A 13: 42,317,760 (GRCm39) C2079S probably damaging Het
Hoxb1 C A 11: 96,257,813 (GRCm39) Q248K probably damaging Het
Hspb6 A G 7: 30,253,772 (GRCm39) D95G probably benign Het
Ighv5-2 T A 12: 113,542,126 (GRCm39) R117S probably damaging Het
Ino80d A C 1: 63,097,769 (GRCm39) S708R probably damaging Het
Mmp15 A G 8: 96,091,942 (GRCm39) N51D probably benign Het
Naip1 T C 13: 100,559,585 (GRCm39) M1140V probably benign Het
Niban2 T A 2: 32,795,838 (GRCm39) V22D probably damaging Het
Or1e1f A G 11: 73,856,291 (GRCm39) N286D probably damaging Het
Or2y8 A G 11: 52,035,520 (GRCm39) V279A probably benign Het
Or8b41 T A 9: 38,054,449 (GRCm39) M1K probably null Het
Or8k21 A G 2: 86,145,409 (GRCm39) S74P probably damaging Het
Parvb C T 15: 84,182,180 (GRCm39) R237W probably damaging Het
Pcdha9 T C 18: 37,131,122 (GRCm39) S64P probably damaging Het
Pdcd1 T C 1: 93,969,114 (GRCm39) N68S probably benign Het
Pi4ka G T 16: 17,143,916 (GRCm39) probably null Het
Plekha4 A T 7: 45,190,310 (GRCm39) D359V possibly damaging Het
Serpinb13 A G 1: 106,921,792 (GRCm39) I78V probably benign Het
Slc39a7 T A 17: 34,249,082 (GRCm39) T269S probably benign Het
Sltm T G 9: 70,480,992 (GRCm39) D281E probably damaging Het
Zfp708 T C 13: 67,219,496 (GRCm39) Y76C probably damaging Het
Zfp990 T A 4: 145,263,497 (GRCm39) V165D possibly damaging Het
Other mutations in Pard3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:Pard3b APN 1 62,200,357 (GRCm39) missense probably damaging 0.99
IGL01363:Pard3b APN 1 62,676,799 (GRCm39) missense probably damaging 1.00
IGL01509:Pard3b APN 1 62,200,407 (GRCm39) missense possibly damaging 0.54
IGL01611:Pard3b APN 1 62,677,021 (GRCm39) missense probably damaging 0.96
IGL01651:Pard3b APN 1 62,518,963 (GRCm39) intron probably benign
IGL01670:Pard3b APN 1 62,250,807 (GRCm39) missense probably damaging 1.00
IGL02156:Pard3b APN 1 61,807,109 (GRCm39) missense possibly damaging 0.84
IGL02232:Pard3b APN 1 62,205,541 (GRCm39) missense probably damaging 1.00
IGL02450:Pard3b APN 1 62,571,835 (GRCm39) missense possibly damaging 0.68
IGL03064:Pard3b APN 1 62,237,930 (GRCm39) splice site probably benign
R0040:Pard3b UTSW 1 62,676,979 (GRCm39) missense probably damaging 1.00
R0040:Pard3b UTSW 1 62,676,979 (GRCm39) missense probably damaging 1.00
R0060:Pard3b UTSW 1 61,678,474 (GRCm39) missense probably damaging 0.97
R0157:Pard3b UTSW 1 62,250,792 (GRCm39) missense probably damaging 0.96
R0333:Pard3b UTSW 1 62,269,371 (GRCm39) missense probably benign 0.00
R0448:Pard3b UTSW 1 62,205,628 (GRCm39) missense probably damaging 1.00
R0465:Pard3b UTSW 1 62,250,877 (GRCm39) splice site probably benign
R0497:Pard3b UTSW 1 62,479,167 (GRCm39) splice site probably null
R1264:Pard3b UTSW 1 62,203,316 (GRCm39) missense probably damaging 1.00
R1468:Pard3b UTSW 1 62,384,188 (GRCm39) missense probably benign 0.00
R1468:Pard3b UTSW 1 62,384,188 (GRCm39) missense probably benign 0.00
R1482:Pard3b UTSW 1 62,205,526 (GRCm39) missense probably damaging 1.00
R1554:Pard3b UTSW 1 62,677,053 (GRCm39) missense probably damaging 0.97
R1836:Pard3b UTSW 1 62,676,763 (GRCm39) missense probably benign 0.03
R2005:Pard3b UTSW 1 62,184,050 (GRCm39) missense probably benign 0.12
R2220:Pard3b UTSW 1 62,518,842 (GRCm39) nonsense probably null
R2435:Pard3b UTSW 1 62,626,897 (GRCm39) missense probably damaging 1.00
R3015:Pard3b UTSW 1 62,384,037 (GRCm39) missense probably damaging 1.00
R3688:Pard3b UTSW 1 62,518,728 (GRCm39) missense probably benign
R3712:Pard3b UTSW 1 62,383,137 (GRCm39) missense probably damaging 1.00
R3799:Pard3b UTSW 1 62,200,388 (GRCm39) missense probably benign 0.06
R3942:Pard3b UTSW 1 62,198,611 (GRCm39) missense probably damaging 1.00
R4683:Pard3b UTSW 1 62,255,675 (GRCm39) missense probably benign
R4729:Pard3b UTSW 1 62,250,843 (GRCm39) missense probably damaging 1.00
R4898:Pard3b UTSW 1 61,807,159 (GRCm39) missense probably damaging 1.00
R4981:Pard3b UTSW 1 62,383,219 (GRCm39) missense probably damaging 1.00
R5049:Pard3b UTSW 1 62,200,320 (GRCm39) missense probably benign 0.01
R5223:Pard3b UTSW 1 62,383,272 (GRCm39) missense probably damaging 1.00
R5476:Pard3b UTSW 1 62,049,565 (GRCm39) missense probably benign 0.10
R5541:Pard3b UTSW 1 61,678,502 (GRCm39) missense probably damaging 1.00
R5672:Pard3b UTSW 1 62,049,625 (GRCm39) missense probably benign 0.11
R5714:Pard3b UTSW 1 62,677,075 (GRCm39) missense probably null 0.99
R5722:Pard3b UTSW 1 62,479,160 (GRCm39) splice site probably null
R5793:Pard3b UTSW 1 61,807,132 (GRCm39) missense probably damaging 1.00
R5930:Pard3b UTSW 1 61,807,289 (GRCm39) intron probably benign
R5950:Pard3b UTSW 1 62,255,690 (GRCm39) missense probably benign 0.04
R5997:Pard3b UTSW 1 62,115,568 (GRCm39) missense probably damaging 1.00
R6646:Pard3b UTSW 1 62,200,280 (GRCm39) missense probably benign 0.32
R6809:Pard3b UTSW 1 62,200,340 (GRCm39) missense probably damaging 1.00
R7148:Pard3b UTSW 1 62,479,191 (GRCm39) missense probably benign 0.01
R7847:Pard3b UTSW 1 62,383,093 (GRCm39) missense probably benign 0.00
R7879:Pard3b UTSW 1 62,198,670 (GRCm39) missense possibly damaging 0.65
R8048:Pard3b UTSW 1 62,193,148 (GRCm39) missense probably damaging 1.00
R8125:Pard3b UTSW 1 61,807,143 (GRCm39) missense probably damaging 1.00
R8329:Pard3b UTSW 1 62,676,957 (GRCm39) missense probably benign 0.30
R8766:Pard3b UTSW 1 62,198,637 (GRCm39) missense probably benign 0.35
R8833:Pard3b UTSW 1 62,384,158 (GRCm39) missense probably benign 0.00
R8889:Pard3b UTSW 1 62,677,026 (GRCm39) missense probably damaging 0.97
R8892:Pard3b UTSW 1 62,677,026 (GRCm39) missense probably damaging 0.97
R8907:Pard3b UTSW 1 62,383,294 (GRCm39) missense probably benign 0.39
R8909:Pard3b UTSW 1 62,383,294 (GRCm39) missense probably benign 0.39
R9215:Pard3b UTSW 1 62,203,344 (GRCm39) missense probably damaging 1.00
R9310:Pard3b UTSW 1 62,205,528 (GRCm39) missense probably damaging 0.99
R9542:Pard3b UTSW 1 62,250,786 (GRCm39) nonsense probably null
Z1176:Pard3b UTSW 1 62,278,051 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGAAAGATGAACCATTTGGCTG -3'
(R):5'- GATGGTCACAGGTTCCATAATGGG -3'

Sequencing Primer
(F):5'- CTGAATAGCTGCAAGCAGA -3'
(R):5'- CCATAATGGGACTTGGCTTGACATTC -3'
Posted On 2018-08-01