Incidental Mutation 'R6720:Farsb'
ID529519
Institutional Source Beutler Lab
Gene Symbol Farsb
Ensembl Gene ENSMUSG00000026245
Gene Namephenylalanyl-tRNA synthetase, beta subunit
SynonymsFarsl, Frsb, PheRS alpha, Farslb
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_011811.3; MGI: 1346035

Is this an essential gene? Probably essential (E-score: 0.971) question?
Stock #R6720 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location78417975-78488897 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 78472497 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 99 (M99T)
Ref Sequence ENSEMBL: ENSMUSP00000139933 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068333] [ENSMUST00000170217] [ENSMUST00000188247] [ENSMUST00000189529] [ENSMUST00000190441]
Predicted Effect probably damaging
Transcript: ENSMUST00000068333
AA Change: M198T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000069508
Gene: ENSMUSG00000026245
AA Change: M198T

DomainStartEndE-ValueType
Blast:B3_4 56 95 6e-14 BLAST
B3_4 117 279 3.29e-29 SMART
B5 304 374 6.31e-17 SMART
SCOP:d1jjcb5 377 586 1e-36 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000170217
AA Change: M198T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000129828
Gene: ENSMUSG00000026245
AA Change: M198T

DomainStartEndE-ValueType
Blast:B3_4 56 95 6e-14 BLAST
B3_4 117 279 3.29e-29 SMART
B5 304 374 6.31e-17 SMART
SCOP:d1jjcb5 377 586 1e-36 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000188247
AA Change: M99T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139933
Gene: ENSMUSG00000026245
AA Change: M99T

DomainStartEndE-ValueType
B3_4 18 180 2.5e-33 SMART
SCOP:d1jjcb2 204 237 3e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000189529
SMART Domains Protein: ENSMUSP00000140001
Gene: ENSMUSG00000026245

DomainStartEndE-ValueType
PDB:3L4G|P 1 38 3e-20 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189931
Predicted Effect probably benign
Transcript: ENSMUST00000190441
SMART Domains Protein: ENSMUSP00000140934
Gene: ENSMUSG00000026245

DomainStartEndE-ValueType
Blast:B3_4 89 128 3e-15 BLAST
Pfam:B3_4 150 206 1e-5 PFAM
Meta Mutation Damage Score 0.6025 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.6%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a highly conserved enzyme that belongs to the aminoacyl-tRNA synthetase class IIc subfamily. This enzyme comprises the regulatory beta subunits that form a tetramer with two catalytic alpha subunits. In the presence of ATP, this tetramer is responsible for attaching L-phenylalanine to the terminal adenosine of the appropriate tRNA. A pseudogene located on chromosome 10 has been identified. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2015]
Allele List at MGI

All alleles(15) : Targeted(2) Gene trapped(13)

Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik G A 4: 137,454,686 E51K possibly damaging Het
Abca1 A C 4: 53,083,733 L700R probably damaging Het
Arpc1a C A 5: 145,101,222 probably null Het
Baz2b G T 2: 59,924,890 P241Q probably damaging Het
Cd6 T A 19: 10,794,609 T414S probably benign Het
Ces2b A T 8: 104,836,869 E409D probably benign Het
Cfap54 A G 10: 92,821,119 Y3024H probably benign Het
Chrm1 A G 19: 8,678,548 T206A probably benign Het
Clptm1l T C 13: 73,618,516 W512R probably damaging Het
Col15a1 T A 4: 47,247,552 probably null Het
Cox15 A G 19: 43,736,789 S392P probably damaging Het
Cr2 T C 1: 195,155,200 M1197V probably damaging Het
Ddx60 A G 8: 62,000,689 K1281E probably benign Het
Dnah11 A G 12: 118,045,646 F2094L probably damaging Het
Ear2 T A 14: 44,102,959 C25S probably damaging Het
Ect2l T C 10: 18,140,264 D802G probably damaging Het
Eftud2 G A 11: 102,838,623 Q84* probably null Het
Eif4g3 T A 4: 138,175,832 probably null Het
Ephb2 T C 4: 136,657,502 D866G probably damaging Het
Fam129b T A 2: 32,905,826 V22D probably damaging Het
Foxs1 T A 2: 152,932,720 S138C probably damaging Het
Frem1 T G 4: 83,013,832 S211R probably damaging Het
Gm19410 G A 8: 35,807,576 R1517Q probably benign Het
Gria2 T C 3: 80,802,304 I27M probably benign Het
H2-Q7 A G 17: 35,442,678 E299G probably benign Het
Hao2 T G 3: 98,877,135 I305L probably benign Het
Hectd4 C T 5: 121,307,381 Q122* probably null Het
Hivep1 T A 13: 42,164,284 C2079S probably damaging Het
Hoxb1 C A 11: 96,366,987 Q248K probably damaging Het
Hspb6 A G 7: 30,554,347 D95G probably benign Het
Ighv5-2 T A 12: 113,578,506 R117S probably damaging Het
Ino80d A C 1: 63,058,610 S708R probably damaging Het
Lman1l A G 9: 57,614,072 probably null Het
Mmp15 A G 8: 95,365,314 N51D probably benign Het
Naip1 T C 13: 100,423,077 M1140V probably benign Het
Olfr1053 A G 2: 86,315,065 S74P probably damaging Het
Olfr1373 A G 11: 52,144,693 V279A probably benign Het
Olfr397 A G 11: 73,965,465 N286D probably damaging Het
Olfr890 T A 9: 38,143,153 M1K probably null Het
Pard3b A T 1: 62,159,470 N239I probably damaging Het
Parvb C T 15: 84,297,979 R237W probably damaging Het
Pcdha9 T C 18: 36,998,069 S64P probably damaging Het
Pdcd1 T C 1: 94,041,389 N68S probably benign Het
Pi4ka G T 16: 17,326,052 probably null Het
Plekha4 A T 7: 45,540,886 D359V possibly damaging Het
Serpinb13 A G 1: 106,994,062 I78V probably benign Het
Slc39a7 T A 17: 34,030,108 T269S probably benign Het
Sltm T G 9: 70,573,710 D281E probably damaging Het
Zfp708 T C 13: 67,071,432 Y76C probably damaging Het
Zfp990 T A 4: 145,536,927 V165D possibly damaging Het
Other mutations in Farsb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Farsb APN 1 78462993 missense probably benign 0.08
IGL01328:Farsb APN 1 78471092 missense probably benign 0.02
IGL01801:Farsb APN 1 78458579 missense probably benign 0.38
R0054:Farsb UTSW 1 78462374 nonsense probably null
R0054:Farsb UTSW 1 78462374 nonsense probably null
R1051:Farsb UTSW 1 78443650 missense possibly damaging 0.49
R1769:Farsb UTSW 1 78466983 missense probably benign 0.06
R4332:Farsb UTSW 1 78469266 missense possibly damaging 0.61
R4664:Farsb UTSW 1 78443765 missense possibly damaging 0.90
R4796:Farsb UTSW 1 78425196 makesense probably null
R4859:Farsb UTSW 1 78467972 missense probably benign 0.01
R5484:Farsb UTSW 1 78476196 missense probably damaging 1.00
R5500:Farsb UTSW 1 78471124 missense probably damaging 1.00
R5557:Farsb UTSW 1 78469251 critical splice donor site probably null
R6109:Farsb UTSW 1 78463270 critical splice donor site probably null
R6368:Farsb UTSW 1 78466965 critical splice donor site probably null
R7166:Farsb UTSW 1 78471184 missense probably benign
R7184:Farsb UTSW 1 78482357 missense possibly damaging 0.86
R7233:Farsb UTSW 1 78471081 critical splice donor site probably null
R7536:Farsb UTSW 1 78443754 missense possibly damaging 0.89
R7753:Farsb UTSW 1 78480103 missense probably benign 0.25
R7824:Farsb UTSW 1 78469299 missense probably benign
R7916:Farsb UTSW 1 78458563 critical splice donor site probably null
R8120:Farsb UTSW 1 78462838 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GACTCCCTCAAAACCACTGTTG -3'
(R):5'- TTCAGAAAATTAGGCTCTCTGGC -3'

Sequencing Primer
(F):5'- GGTAAGGGTACTTTCCTCCTACAAG -3'
(R):5'- GGCTCTCTGGCTCTCATTTC -3'
Posted On2018-08-01