Incidental Mutation 'R6720:Pdcd1'
ID 529520
Institutional Source Beutler Lab
Gene Symbol Pdcd1
Ensembl Gene ENSMUSG00000026285
Gene Name programmed cell death 1
Synonyms Pdc1, PD-1
MMRRC Submission 044838-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.339) question?
Stock # R6720 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 93966027-93980278 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 93969114 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 68 (N68S)
Ref Sequence ENSEMBL: ENSMUSP00000027507 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027507]
AlphaFold Q02242
PDB Structure CRYSTAL STRUCTURE OF THE EXTRACELLULAR DOMAIN OF MURINE PD-1 [X-RAY DIFFRACTION]
Crystal Structure of the PD-1/PD-L1 Complex [X-RAY DIFFRACTION]
Crystal structure of the mouse PD-1 and PD-L2 complex [X-RAY DIFFRACTION]
Crystal structure of the mouse PD-1 Mutant and PD-L2 complex [X-RAY DIFFRACTION]
Crystal structure of the complex between mouse PD-1 mutant and PD-L2 IgV domain [X-RAY DIFFRACTION]
Crystal structure of the complex between the extracellular domains of mouse PD-1 mutant and PD-L2 [X-RAY DIFFRACTION]
Crystal structure of the complex between the extracellular domains of mouse PD-1 mutant and human PD-L1 [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000027507
AA Change: N68S

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000027507
Gene: ENSMUSG00000026285
AA Change: N68S

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 39 145 3.33e-9 SMART
transmembrane domain 170 192 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.6%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cell surface membrane protein of the immunoglobulin superfamily. This protein is expressed in pro-B-cells and is thought to play a role in their differentiation. In mice, expression of this gene is induced in the thymus when anti-CD3 antibodies are injected and large numbers of thymocytes undergo apoptosis. Mice deficient for this gene bred on a BALB/c background developed dilated cardiomyopathy and died from congestive heart failure. These studies suggest that this gene product may also be important in T cell function and contribute to the prevention of autoimmune diseases. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display abnormalities in leukopoiesis and the immune system which vary considerably depending on the genetic background. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik G A 4: 137,181,997 (GRCm39) E51K possibly damaging Het
Abca1 A C 4: 53,083,733 (GRCm39) L700R probably damaging Het
Arpc1a C A 5: 145,038,032 (GRCm39) probably null Het
Baz2b G T 2: 59,755,234 (GRCm39) P241Q probably damaging Het
Cd6 T A 19: 10,771,973 (GRCm39) T414S probably benign Het
Ces2b A T 8: 105,563,501 (GRCm39) E409D probably benign Het
Cfap54 A G 10: 92,656,981 (GRCm39) Y3024H probably benign Het
Chrm1 A G 19: 8,655,912 (GRCm39) T206A probably benign Het
Clptm1l T C 13: 73,766,635 (GRCm39) W512R probably damaging Het
Col15a1 T A 4: 47,247,552 (GRCm39) probably null Het
Cox15 A G 19: 43,725,228 (GRCm39) S392P probably damaging Het
Cplx3 A G 9: 57,521,355 (GRCm39) probably null Het
Cr2 T C 1: 194,837,508 (GRCm39) M1197V probably damaging Het
Ddx60 A G 8: 62,453,723 (GRCm39) K1281E probably benign Het
Dnah11 A G 12: 118,009,381 (GRCm39) F2094L probably damaging Het
Ear2 T A 14: 44,340,416 (GRCm39) C25S probably damaging Het
Ect2l T C 10: 18,016,012 (GRCm39) D802G probably damaging Het
Eftud2 G A 11: 102,729,449 (GRCm39) Q84* probably null Het
Eif4g3 T A 4: 137,903,143 (GRCm39) probably null Het
Ephb2 T C 4: 136,384,813 (GRCm39) D866G probably damaging Het
Farsb A G 1: 78,449,134 (GRCm39) M99T probably damaging Het
Foxs1 T A 2: 152,774,640 (GRCm39) S138C probably damaging Het
Frem1 T G 4: 82,932,069 (GRCm39) S211R probably damaging Het
Gm19410 G A 8: 36,274,730 (GRCm39) R1517Q probably benign Het
Gria2 T C 3: 80,709,611 (GRCm39) I27M probably benign Het
H2-Q7 A G 17: 35,661,654 (GRCm39) E299G probably benign Het
Hao2 T G 3: 98,784,451 (GRCm39) I305L probably benign Het
Hectd4 C T 5: 121,445,444 (GRCm39) Q122* probably null Het
Hivep1 T A 13: 42,317,760 (GRCm39) C2079S probably damaging Het
Hoxb1 C A 11: 96,257,813 (GRCm39) Q248K probably damaging Het
Hspb6 A G 7: 30,253,772 (GRCm39) D95G probably benign Het
Ighv5-2 T A 12: 113,542,126 (GRCm39) R117S probably damaging Het
Ino80d A C 1: 63,097,769 (GRCm39) S708R probably damaging Het
Mmp15 A G 8: 96,091,942 (GRCm39) N51D probably benign Het
Naip1 T C 13: 100,559,585 (GRCm39) M1140V probably benign Het
Niban2 T A 2: 32,795,838 (GRCm39) V22D probably damaging Het
Or1e1f A G 11: 73,856,291 (GRCm39) N286D probably damaging Het
Or2y8 A G 11: 52,035,520 (GRCm39) V279A probably benign Het
Or8b41 T A 9: 38,054,449 (GRCm39) M1K probably null Het
Or8k21 A G 2: 86,145,409 (GRCm39) S74P probably damaging Het
Pard3b A T 1: 62,198,629 (GRCm39) N239I probably damaging Het
Parvb C T 15: 84,182,180 (GRCm39) R237W probably damaging Het
Pcdha9 T C 18: 37,131,122 (GRCm39) S64P probably damaging Het
Pi4ka G T 16: 17,143,916 (GRCm39) probably null Het
Plekha4 A T 7: 45,190,310 (GRCm39) D359V possibly damaging Het
Serpinb13 A G 1: 106,921,792 (GRCm39) I78V probably benign Het
Slc39a7 T A 17: 34,249,082 (GRCm39) T269S probably benign Het
Sltm T G 9: 70,480,992 (GRCm39) D281E probably damaging Het
Zfp708 T C 13: 67,219,496 (GRCm39) Y76C probably damaging Het
Zfp990 T A 4: 145,263,497 (GRCm39) V165D possibly damaging Het
Other mutations in Pdcd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Pdcd1 APN 1 93,967,860 (GRCm39) splice site probably benign
IGL01522:Pdcd1 APN 1 93,968,571 (GRCm39) missense probably benign 0.00
IGL02337:Pdcd1 APN 1 93,968,582 (GRCm39) missense probably benign 0.08
IGL02750:Pdcd1 APN 1 93,967,269 (GRCm39) splice site probably benign
R6720_pdcd1_520 UTSW 1 93,969,114 (GRCm39) missense probably benign 0.00
R0092:Pdcd1 UTSW 1 93,980,149 (GRCm39) missense possibly damaging 0.49
R0554:Pdcd1 UTSW 1 93,967,107 (GRCm39) missense probably damaging 1.00
R0931:Pdcd1 UTSW 1 93,967,238 (GRCm39) missense probably benign 0.05
R3932:Pdcd1 UTSW 1 93,968,989 (GRCm39) missense probably benign 0.01
R5222:Pdcd1 UTSW 1 93,980,175 (GRCm39) missense probably damaging 0.99
R5914:Pdcd1 UTSW 1 93,968,550 (GRCm39) missense probably benign 0.15
R6186:Pdcd1 UTSW 1 93,967,846 (GRCm39) nonsense probably null
R6844:Pdcd1 UTSW 1 93,967,106 (GRCm39) missense probably benign 0.36
R7966:Pdcd1 UTSW 1 93,969,186 (GRCm39) missense probably damaging 1.00
R8233:Pdcd1 UTSW 1 93,967,142 (GRCm39) missense probably damaging 1.00
R8387:Pdcd1 UTSW 1 93,969,193 (GRCm39) missense probably damaging 1.00
R8677:Pdcd1 UTSW 1 93,968,952 (GRCm39) missense probably damaging 1.00
R8724:Pdcd1 UTSW 1 93,968,956 (GRCm39) missense probably damaging 1.00
R8823:Pdcd1 UTSW 1 93,969,220 (GRCm39) missense probably benign 0.00
R8875:Pdcd1 UTSW 1 93,967,092 (GRCm39) missense probably benign 0.06
R8876:Pdcd1 UTSW 1 93,980,155 (GRCm39) missense probably benign
R9041:Pdcd1 UTSW 1 93,969,091 (GRCm39) missense probably benign 0.33
R9081:Pdcd1 UTSW 1 93,968,880 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ACCTGTTACCACGAGCTCTG -3'
(R):5'- AAAGGGTGTACAGGCTCCTTC -3'

Sequencing Primer
(F):5'- AGGGCTCTCCTCGATTTTTG -3'
(R):5'- GTGTACAGGCTCCTTCCTCACAG -3'
Posted On 2018-08-01