Incidental Mutation 'R6720:Pdcd1'
ID529520
Institutional Source Beutler Lab
Gene Symbol Pdcd1
Ensembl Gene ENSMUSG00000026285
Gene Nameprogrammed cell death 1
SynonymsPD-1, Pdc1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R6720 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location94038305-94052553 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 94041389 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 68 (N68S)
Ref Sequence ENSEMBL: ENSMUSP00000027507 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027507]
PDB Structure
CRYSTAL STRUCTURE OF THE EXTRACELLULAR DOMAIN OF MURINE PD-1 [X-RAY DIFFRACTION]
Crystal Structure of the PD-1/PD-L1 Complex [X-RAY DIFFRACTION]
Crystal structure of the mouse PD-1 and PD-L2 complex [X-RAY DIFFRACTION]
Crystal structure of the mouse PD-1 Mutant and PD-L2 complex [X-RAY DIFFRACTION]
Crystal structure of the complex between mouse PD-1 mutant and PD-L2 IgV domain [X-RAY DIFFRACTION]
Crystal structure of the complex between the extracellular domains of mouse PD-1 mutant and PD-L2 [X-RAY DIFFRACTION]
Crystal structure of the complex between the extracellular domains of mouse PD-1 mutant and human PD-L1 [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000027507
AA Change: N68S

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000027507
Gene: ENSMUSG00000026285
AA Change: N68S

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 39 145 3.33e-9 SMART
transmembrane domain 170 192 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.6%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cell surface membrane protein of the immunoglobulin superfamily. This protein is expressed in pro-B-cells and is thought to play a role in their differentiation. In mice, expression of this gene is induced in the thymus when anti-CD3 antibodies are injected and large numbers of thymocytes undergo apoptosis. Mice deficient for this gene bred on a BALB/c background developed dilated cardiomyopathy and died from congestive heart failure. These studies suggest that this gene product may also be important in T cell function and contribute to the prevention of autoimmune diseases. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display abnormalities in leukopoiesis and the immune system which vary considerably depending on the genetic background. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik G A 4: 137,454,686 E51K possibly damaging Het
Abca1 A C 4: 53,083,733 L700R probably damaging Het
Arpc1a C A 5: 145,101,222 probably null Het
Baz2b G T 2: 59,924,890 P241Q probably damaging Het
Cd6 T A 19: 10,794,609 T414S probably benign Het
Ces2b A T 8: 104,836,869 E409D probably benign Het
Cfap54 A G 10: 92,821,119 Y3024H probably benign Het
Chrm1 A G 19: 8,678,548 T206A probably benign Het
Clptm1l T C 13: 73,618,516 W512R probably damaging Het
Col15a1 T A 4: 47,247,552 probably null Het
Cox15 A G 19: 43,736,789 S392P probably damaging Het
Cr2 T C 1: 195,155,200 M1197V probably damaging Het
Ddx60 A G 8: 62,000,689 K1281E probably benign Het
Dnah11 A G 12: 118,045,646 F2094L probably damaging Het
Ear2 T A 14: 44,102,959 C25S probably damaging Het
Ect2l T C 10: 18,140,264 D802G probably damaging Het
Eftud2 G A 11: 102,838,623 Q84* probably null Het
Eif4g3 T A 4: 138,175,832 probably null Het
Ephb2 T C 4: 136,657,502 D866G probably damaging Het
Fam129b T A 2: 32,905,826 V22D probably damaging Het
Farsb A G 1: 78,472,497 M99T probably damaging Het
Foxs1 T A 2: 152,932,720 S138C probably damaging Het
Frem1 T G 4: 83,013,832 S211R probably damaging Het
Gm19410 G A 8: 35,807,576 R1517Q probably benign Het
Gria2 T C 3: 80,802,304 I27M probably benign Het
H2-Q7 A G 17: 35,442,678 E299G probably benign Het
Hao2 T G 3: 98,877,135 I305L probably benign Het
Hectd4 C T 5: 121,307,381 Q122* probably null Het
Hivep1 T A 13: 42,164,284 C2079S probably damaging Het
Hoxb1 C A 11: 96,366,987 Q248K probably damaging Het
Hspb6 A G 7: 30,554,347 D95G probably benign Het
Ighv5-2 T A 12: 113,578,506 R117S probably damaging Het
Ino80d A C 1: 63,058,610 S708R probably damaging Het
Lman1l A G 9: 57,614,072 probably null Het
Mmp15 A G 8: 95,365,314 N51D probably benign Het
Naip1 T C 13: 100,423,077 M1140V probably benign Het
Olfr1053 A G 2: 86,315,065 S74P probably damaging Het
Olfr1373 A G 11: 52,144,693 V279A probably benign Het
Olfr397 A G 11: 73,965,465 N286D probably damaging Het
Olfr890 T A 9: 38,143,153 M1K probably null Het
Pard3b A T 1: 62,159,470 N239I probably damaging Het
Parvb C T 15: 84,297,979 R237W probably damaging Het
Pcdha9 T C 18: 36,998,069 S64P probably damaging Het
Pi4ka G T 16: 17,326,052 probably null Het
Plekha4 A T 7: 45,540,886 D359V possibly damaging Het
Serpinb13 A G 1: 106,994,062 I78V probably benign Het
Slc39a7 T A 17: 34,030,108 T269S probably benign Het
Sltm T G 9: 70,573,710 D281E probably damaging Het
Zfp708 T C 13: 67,071,432 Y76C probably damaging Het
Zfp990 T A 4: 145,536,927 V165D possibly damaging Het
Other mutations in Pdcd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Pdcd1 APN 1 94040135 splice site probably benign
IGL01522:Pdcd1 APN 1 94040846 missense probably benign 0.00
IGL02337:Pdcd1 APN 1 94040857 missense probably benign 0.08
IGL02750:Pdcd1 APN 1 94039544 splice site probably benign
R6720_Pdcd1_520 UTSW 1 94041389 missense probably benign 0.00
R0092:Pdcd1 UTSW 1 94052424 missense possibly damaging 0.49
R0554:Pdcd1 UTSW 1 94039382 missense probably damaging 1.00
R0931:Pdcd1 UTSW 1 94039513 missense probably benign 0.05
R3932:Pdcd1 UTSW 1 94041264 missense probably benign 0.01
R5222:Pdcd1 UTSW 1 94052450 missense probably damaging 0.99
R5914:Pdcd1 UTSW 1 94040825 missense probably benign 0.15
R6186:Pdcd1 UTSW 1 94040121 nonsense probably null
R6844:Pdcd1 UTSW 1 94039381 missense probably benign 0.36
R8233:Pdcd1 UTSW 1 94039417 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCTGTTACCACGAGCTCTG -3'
(R):5'- AAAGGGTGTACAGGCTCCTTC -3'

Sequencing Primer
(F):5'- AGGGCTCTCCTCGATTTTTG -3'
(R):5'- GTGTACAGGCTCCTTCCTCACAG -3'
Posted On2018-08-01