Incidental Mutation 'R6720:Or8k21'
ID 529524
Institutional Source Beutler Lab
Gene Symbol Or8k21
Ensembl Gene ENSMUSG00000075192
Gene Name olfactory receptor family 8 subfamily K member 21
Synonyms GA_x6K02T2Q125-47793414-47792471, MOR187-4, Olfr1053-ps1, Olfr1053
MMRRC Submission 044838-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.090) question?
Stock # R6720 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 86144687-86145628 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 86145409 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 74 (S74P)
Ref Sequence ENSEMBL: ENSMUSP00000097481 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099897]
AlphaFold L7MU59
Predicted Effect probably damaging
Transcript: ENSMUST00000099897
AA Change: S74P

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000097481
Gene: ENSMUSG00000075192
AA Change: S74P

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1e-45 PFAM
Pfam:7tm_1 41 290 1.2e-17 PFAM
Meta Mutation Damage Score 0.6763 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.6%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik G A 4: 137,181,997 (GRCm39) E51K possibly damaging Het
Abca1 A C 4: 53,083,733 (GRCm39) L700R probably damaging Het
Arpc1a C A 5: 145,038,032 (GRCm39) probably null Het
Baz2b G T 2: 59,755,234 (GRCm39) P241Q probably damaging Het
Cd6 T A 19: 10,771,973 (GRCm39) T414S probably benign Het
Ces2b A T 8: 105,563,501 (GRCm39) E409D probably benign Het
Cfap54 A G 10: 92,656,981 (GRCm39) Y3024H probably benign Het
Chrm1 A G 19: 8,655,912 (GRCm39) T206A probably benign Het
Clptm1l T C 13: 73,766,635 (GRCm39) W512R probably damaging Het
Col15a1 T A 4: 47,247,552 (GRCm39) probably null Het
Cox15 A G 19: 43,725,228 (GRCm39) S392P probably damaging Het
Cplx3 A G 9: 57,521,355 (GRCm39) probably null Het
Cr2 T C 1: 194,837,508 (GRCm39) M1197V probably damaging Het
Ddx60 A G 8: 62,453,723 (GRCm39) K1281E probably benign Het
Dnah11 A G 12: 118,009,381 (GRCm39) F2094L probably damaging Het
Ear2 T A 14: 44,340,416 (GRCm39) C25S probably damaging Het
Ect2l T C 10: 18,016,012 (GRCm39) D802G probably damaging Het
Eftud2 G A 11: 102,729,449 (GRCm39) Q84* probably null Het
Eif4g3 T A 4: 137,903,143 (GRCm39) probably null Het
Ephb2 T C 4: 136,384,813 (GRCm39) D866G probably damaging Het
Farsb A G 1: 78,449,134 (GRCm39) M99T probably damaging Het
Foxs1 T A 2: 152,774,640 (GRCm39) S138C probably damaging Het
Frem1 T G 4: 82,932,069 (GRCm39) S211R probably damaging Het
Gm19410 G A 8: 36,274,730 (GRCm39) R1517Q probably benign Het
Gria2 T C 3: 80,709,611 (GRCm39) I27M probably benign Het
H2-Q7 A G 17: 35,661,654 (GRCm39) E299G probably benign Het
Hao2 T G 3: 98,784,451 (GRCm39) I305L probably benign Het
Hectd4 C T 5: 121,445,444 (GRCm39) Q122* probably null Het
Hivep1 T A 13: 42,317,760 (GRCm39) C2079S probably damaging Het
Hoxb1 C A 11: 96,257,813 (GRCm39) Q248K probably damaging Het
Hspb6 A G 7: 30,253,772 (GRCm39) D95G probably benign Het
Ighv5-2 T A 12: 113,542,126 (GRCm39) R117S probably damaging Het
Ino80d A C 1: 63,097,769 (GRCm39) S708R probably damaging Het
Mmp15 A G 8: 96,091,942 (GRCm39) N51D probably benign Het
Naip1 T C 13: 100,559,585 (GRCm39) M1140V probably benign Het
Niban2 T A 2: 32,795,838 (GRCm39) V22D probably damaging Het
Or1e1f A G 11: 73,856,291 (GRCm39) N286D probably damaging Het
Or2y8 A G 11: 52,035,520 (GRCm39) V279A probably benign Het
Or8b41 T A 9: 38,054,449 (GRCm39) M1K probably null Het
Pard3b A T 1: 62,198,629 (GRCm39) N239I probably damaging Het
Parvb C T 15: 84,182,180 (GRCm39) R237W probably damaging Het
Pcdha9 T C 18: 37,131,122 (GRCm39) S64P probably damaging Het
Pdcd1 T C 1: 93,969,114 (GRCm39) N68S probably benign Het
Pi4ka G T 16: 17,143,916 (GRCm39) probably null Het
Plekha4 A T 7: 45,190,310 (GRCm39) D359V possibly damaging Het
Serpinb13 A G 1: 106,921,792 (GRCm39) I78V probably benign Het
Slc39a7 T A 17: 34,249,082 (GRCm39) T269S probably benign Het
Sltm T G 9: 70,480,992 (GRCm39) D281E probably damaging Het
Zfp708 T C 13: 67,219,496 (GRCm39) Y76C probably damaging Het
Zfp990 T A 4: 145,263,497 (GRCm39) V165D possibly damaging Het
Other mutations in Or8k21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01010:Or8k21 APN 2 86,145,288 (GRCm39) missense probably damaging 1.00
IGL02063:Or8k21 APN 2 86,145,137 (GRCm39) missense possibly damaging 0.50
IGL02503:Or8k21 APN 2 86,144,983 (GRCm39) missense possibly damaging 0.71
IGL03342:Or8k21 APN 2 86,145,579 (GRCm39) missense possibly damaging 0.85
PIT4520001:Or8k21 UTSW 2 86,145,142 (GRCm39) missense possibly damaging 0.78
R0562:Or8k21 UTSW 2 86,144,869 (GRCm39) missense probably benign 0.00
R1026:Or8k21 UTSW 2 86,145,558 (GRCm39) missense possibly damaging 0.80
R1134:Or8k21 UTSW 2 86,145,525 (GRCm39) missense probably damaging 1.00
R1200:Or8k21 UTSW 2 86,145,477 (GRCm39) missense probably damaging 0.99
R1566:Or8k21 UTSW 2 86,145,129 (GRCm39) missense probably benign 0.01
R1588:Or8k21 UTSW 2 86,144,874 (GRCm39) missense probably damaging 1.00
R1747:Or8k21 UTSW 2 86,145,211 (GRCm39) missense probably benign 0.00
R1951:Or8k21 UTSW 2 86,145,504 (GRCm39) missense probably damaging 1.00
R1975:Or8k21 UTSW 2 86,145,498 (GRCm39) missense probably damaging 0.99
R2291:Or8k21 UTSW 2 86,145,524 (GRCm39) nonsense probably null
R2425:Or8k21 UTSW 2 86,144,739 (GRCm39) missense probably damaging 0.98
R5092:Or8k21 UTSW 2 86,144,706 (GRCm39) missense probably benign 0.00
R5651:Or8k21 UTSW 2 86,144,784 (GRCm39) missense probably benign 0.23
R5733:Or8k21 UTSW 2 86,145,558 (GRCm39) missense probably damaging 0.98
R5767:Or8k21 UTSW 2 86,144,742 (GRCm39) missense probably damaging 1.00
R6307:Or8k21 UTSW 2 86,145,468 (GRCm39) missense probably benign
R7067:Or8k21 UTSW 2 86,144,911 (GRCm39) missense probably damaging 1.00
R7289:Or8k21 UTSW 2 86,145,369 (GRCm39) missense probably benign 0.00
R7604:Or8k21 UTSW 2 86,145,244 (GRCm39) missense probably damaging 1.00
R7773:Or8k21 UTSW 2 86,145,034 (GRCm39) missense probably benign 0.01
R8345:Or8k21 UTSW 2 86,145,451 (GRCm39) missense probably damaging 1.00
R9246:Or8k21 UTSW 2 86,145,222 (GRCm39) missense probably damaging 0.99
R9454:Or8k21 UTSW 2 86,145,178 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCTGAGACATGATCACACTGTAG -3'
(R):5'- CAACATCACTGCCTGGGTTC -3'

Sequencing Primer
(F):5'- TGTAGAGCAGAGGGTTGCAGATG -3'
(R):5'- TCTTGATGGGAATCACACAGC -3'
Posted On 2018-08-01