Incidental Mutation 'R6720:Olfr1053'
ID529524
Institutional Source Beutler Lab
Gene Symbol Olfr1053
Ensembl Gene ENSMUSG00000075192
Gene Nameolfactory receptor 1053
SynonymsGA_x6K02T2Q125-47793414-47792471, Olfr1053-ps1, MOR187-4
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R6720 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location86314343-86315284 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 86315065 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 74 (S74P)
Ref Sequence ENSEMBL: ENSMUSP00000097481 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099897]
Predicted Effect probably damaging
Transcript: ENSMUST00000099897
AA Change: S74P

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000097481
Gene: ENSMUSG00000075192
AA Change: S74P

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1e-45 PFAM
Pfam:7tm_1 41 290 1.2e-17 PFAM
Meta Mutation Damage Score 0.6763 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.6%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik G A 4: 137,454,686 E51K possibly damaging Het
Abca1 A C 4: 53,083,733 L700R probably damaging Het
Arpc1a C A 5: 145,101,222 probably null Het
Baz2b G T 2: 59,924,890 P241Q probably damaging Het
Cd6 T A 19: 10,794,609 T414S probably benign Het
Ces2b A T 8: 104,836,869 E409D probably benign Het
Cfap54 A G 10: 92,821,119 Y3024H probably benign Het
Chrm1 A G 19: 8,678,548 T206A probably benign Het
Clptm1l T C 13: 73,618,516 W512R probably damaging Het
Col15a1 T A 4: 47,247,552 probably null Het
Cox15 A G 19: 43,736,789 S392P probably damaging Het
Cr2 T C 1: 195,155,200 M1197V probably damaging Het
Ddx60 A G 8: 62,000,689 K1281E probably benign Het
Dnah11 A G 12: 118,045,646 F2094L probably damaging Het
Ear2 T A 14: 44,102,959 C25S probably damaging Het
Ect2l T C 10: 18,140,264 D802G probably damaging Het
Eftud2 G A 11: 102,838,623 Q84* probably null Het
Eif4g3 T A 4: 138,175,832 probably null Het
Ephb2 T C 4: 136,657,502 D866G probably damaging Het
Fam129b T A 2: 32,905,826 V22D probably damaging Het
Farsb A G 1: 78,472,497 M99T probably damaging Het
Foxs1 T A 2: 152,932,720 S138C probably damaging Het
Frem1 T G 4: 83,013,832 S211R probably damaging Het
Gm19410 G A 8: 35,807,576 R1517Q probably benign Het
Gria2 T C 3: 80,802,304 I27M probably benign Het
H2-Q7 A G 17: 35,442,678 E299G probably benign Het
Hao2 T G 3: 98,877,135 I305L probably benign Het
Hectd4 C T 5: 121,307,381 Q122* probably null Het
Hivep1 T A 13: 42,164,284 C2079S probably damaging Het
Hoxb1 C A 11: 96,366,987 Q248K probably damaging Het
Hspb6 A G 7: 30,554,347 D95G probably benign Het
Ighv5-2 T A 12: 113,578,506 R117S probably damaging Het
Ino80d A C 1: 63,058,610 S708R probably damaging Het
Lman1l A G 9: 57,614,072 probably null Het
Mmp15 A G 8: 95,365,314 N51D probably benign Het
Naip1 T C 13: 100,423,077 M1140V probably benign Het
Olfr1373 A G 11: 52,144,693 V279A probably benign Het
Olfr397 A G 11: 73,965,465 N286D probably damaging Het
Olfr890 T A 9: 38,143,153 M1K probably null Het
Pard3b A T 1: 62,159,470 N239I probably damaging Het
Parvb C T 15: 84,297,979 R237W probably damaging Het
Pcdha9 T C 18: 36,998,069 S64P probably damaging Het
Pdcd1 T C 1: 94,041,389 N68S probably benign Het
Pi4ka G T 16: 17,326,052 probably null Het
Plekha4 A T 7: 45,540,886 D359V possibly damaging Het
Serpinb13 A G 1: 106,994,062 I78V probably benign Het
Slc39a7 T A 17: 34,030,108 T269S probably benign Het
Sltm T G 9: 70,573,710 D281E probably damaging Het
Zfp708 T C 13: 67,071,432 Y76C probably damaging Het
Zfp990 T A 4: 145,536,927 V165D possibly damaging Het
Other mutations in Olfr1053
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01010:Olfr1053 APN 2 86314944 missense probably damaging 1.00
IGL02063:Olfr1053 APN 2 86314793 missense possibly damaging 0.50
IGL02503:Olfr1053 APN 2 86314639 missense possibly damaging 0.71
IGL03342:Olfr1053 APN 2 86315235 missense possibly damaging 0.85
PIT4520001:Olfr1053 UTSW 2 86314798 missense possibly damaging 0.78
R0562:Olfr1053 UTSW 2 86314525 missense probably benign 0.00
R1026:Olfr1053 UTSW 2 86315214 missense possibly damaging 0.80
R1134:Olfr1053 UTSW 2 86315181 missense probably damaging 1.00
R1200:Olfr1053 UTSW 2 86315133 missense probably damaging 0.99
R1566:Olfr1053 UTSW 2 86314785 missense probably benign 0.01
R1588:Olfr1053 UTSW 2 86314530 missense probably damaging 1.00
R1747:Olfr1053 UTSW 2 86314867 missense probably benign 0.00
R1951:Olfr1053 UTSW 2 86315160 missense probably damaging 1.00
R1975:Olfr1053 UTSW 2 86315154 missense probably damaging 0.99
R2291:Olfr1053 UTSW 2 86315180 nonsense probably null
R2425:Olfr1053 UTSW 2 86314395 missense probably damaging 0.98
R5092:Olfr1053 UTSW 2 86314362 missense probably benign 0.00
R5651:Olfr1053 UTSW 2 86314440 missense probably benign 0.23
R5733:Olfr1053 UTSW 2 86315214 missense probably damaging 0.98
R5767:Olfr1053 UTSW 2 86314398 missense probably damaging 1.00
R6307:Olfr1053 UTSW 2 86315124 missense probably benign
R7067:Olfr1053 UTSW 2 86314567 missense probably damaging 1.00
R7289:Olfr1053 UTSW 2 86315025 missense probably benign 0.00
R7604:Olfr1053 UTSW 2 86314900 missense probably damaging 1.00
R7773:Olfr1053 UTSW 2 86314690 missense probably benign 0.01
R8345:Olfr1053 UTSW 2 86315107 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCTGAGACATGATCACACTGTAG -3'
(R):5'- CAACATCACTGCCTGGGTTC -3'

Sequencing Primer
(F):5'- TGTAGAGCAGAGGGTTGCAGATG -3'
(R):5'- TCTTGATGGGAATCACACAGC -3'
Posted On2018-08-01