Incidental Mutation 'R6720:Foxs1'
ID529525
Institutional Source Beutler Lab
Gene Symbol Foxs1
Ensembl Gene ENSMUSG00000074676
Gene Nameforkhead box S1
SynonymsFkh3, FREAC10, Fkhl18
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.287) question?
Stock #R6720 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location152931898-152933208 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 152932720 bp
ZygosityHeterozygous
Amino Acid Change Serine to Cysteine at position 138 (S138C)
Ref Sequence ENSEMBL: ENSMUSP00000096806 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099200]
Predicted Effect probably damaging
Transcript: ENSMUST00000099200
AA Change: S138C

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000096806
Gene: ENSMUSG00000074676
AA Change: S138C

DomainStartEndE-ValueType
FH 16 106 1.88e-60 SMART
low complexity region 269 283 N/A INTRINSIC
Meta Mutation Damage Score 0.0618 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.6%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The forkhead family of transcription factors belongs to the winged helix class of DNA-binding proteins. The protein encoded by this intronless gene contains a forkhead domain and is found predominantly in aorta and kidney. The function of the encoded protein is unknown. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for one reporter allele display enhanced rotarod performance and increased male resistance to diet-induced obesity. Homozygotes for another reporter allele show impaired testicular vasculature, including blood accumulation in fetal testis and marked apoptosis of periendothelial cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik G A 4: 137,454,686 E51K possibly damaging Het
Abca1 A C 4: 53,083,733 L700R probably damaging Het
Arpc1a C A 5: 145,101,222 probably null Het
Baz2b G T 2: 59,924,890 P241Q probably damaging Het
Cd6 T A 19: 10,794,609 T414S probably benign Het
Ces2b A T 8: 104,836,869 E409D probably benign Het
Cfap54 A G 10: 92,821,119 Y3024H probably benign Het
Chrm1 A G 19: 8,678,548 T206A probably benign Het
Clptm1l T C 13: 73,618,516 W512R probably damaging Het
Col15a1 T A 4: 47,247,552 probably null Het
Cox15 A G 19: 43,736,789 S392P probably damaging Het
Cr2 T C 1: 195,155,200 M1197V probably damaging Het
Ddx60 A G 8: 62,000,689 K1281E probably benign Het
Dnah11 A G 12: 118,045,646 F2094L probably damaging Het
Ear2 T A 14: 44,102,959 C25S probably damaging Het
Ect2l T C 10: 18,140,264 D802G probably damaging Het
Eftud2 G A 11: 102,838,623 Q84* probably null Het
Eif4g3 T A 4: 138,175,832 probably null Het
Ephb2 T C 4: 136,657,502 D866G probably damaging Het
Fam129b T A 2: 32,905,826 V22D probably damaging Het
Farsb A G 1: 78,472,497 M99T probably damaging Het
Frem1 T G 4: 83,013,832 S211R probably damaging Het
Gm19410 G A 8: 35,807,576 R1517Q probably benign Het
Gria2 T C 3: 80,802,304 I27M probably benign Het
H2-Q7 A G 17: 35,442,678 E299G probably benign Het
Hao2 T G 3: 98,877,135 I305L probably benign Het
Hectd4 C T 5: 121,307,381 Q122* probably null Het
Hivep1 T A 13: 42,164,284 C2079S probably damaging Het
Hoxb1 C A 11: 96,366,987 Q248K probably damaging Het
Hspb6 A G 7: 30,554,347 D95G probably benign Het
Ighv5-2 T A 12: 113,578,506 R117S probably damaging Het
Ino80d A C 1: 63,058,610 S708R probably damaging Het
Lman1l A G 9: 57,614,072 probably null Het
Mmp15 A G 8: 95,365,314 N51D probably benign Het
Naip1 T C 13: 100,423,077 M1140V probably benign Het
Olfr1053 A G 2: 86,315,065 S74P probably damaging Het
Olfr1373 A G 11: 52,144,693 V279A probably benign Het
Olfr397 A G 11: 73,965,465 N286D probably damaging Het
Olfr890 T A 9: 38,143,153 M1K probably null Het
Pard3b A T 1: 62,159,470 N239I probably damaging Het
Parvb C T 15: 84,297,979 R237W probably damaging Het
Pcdha9 T C 18: 36,998,069 S64P probably damaging Het
Pdcd1 T C 1: 94,041,389 N68S probably benign Het
Pi4ka G T 16: 17,326,052 probably null Het
Plekha4 A T 7: 45,540,886 D359V possibly damaging Het
Serpinb13 A G 1: 106,994,062 I78V probably benign Het
Slc39a7 T A 17: 34,030,108 T269S probably benign Het
Sltm T G 9: 70,573,710 D281E probably damaging Het
Zfp708 T C 13: 67,071,432 Y76C probably damaging Het
Zfp990 T A 4: 145,536,927 V165D possibly damaging Het
Other mutations in Foxs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01641:Foxs1 APN 2 152932312 missense probably benign
IGL02304:Foxs1 APN 2 152932350 missense probably benign 0.01
IGL02491:Foxs1 APN 2 152932801 missense probably damaging 1.00
IGL03009:Foxs1 APN 2 152932929 missense probably damaging 1.00
IGL03046:Foxs1 UTSW 2 152932564 missense probably benign 0.00
R0158:Foxs1 UTSW 2 152932410 missense probably damaging 1.00
R0324:Foxs1 UTSW 2 152932687 missense probably benign 0.02
R1616:Foxs1 UTSW 2 152932639 missense probably benign 0.37
R1915:Foxs1 UTSW 2 152932840 missense probably damaging 0.99
R3113:Foxs1 UTSW 2 152932236 missense probably benign 0.00
R4885:Foxs1 UTSW 2 152932381 missense probably benign 0.00
R6084:Foxs1 UTSW 2 152932842 missense possibly damaging 0.81
R6265:Foxs1 UTSW 2 152932178 nonsense probably null
R6828:Foxs1 UTSW 2 152933128 nonsense probably null
R6845:Foxs1 UTSW 2 152932699 missense probably benign
R7456:Foxs1 UTSW 2 152933125 missense probably benign
R7577:Foxs1 UTSW 2 152932441 missense probably benign 0.01
R7746:Foxs1 UTSW 2 152933108 missense probably benign
R7841:Foxs1 UTSW 2 152932987 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- GACTTTGCCGAGCACATCTC -3'
(R):5'- GCCATAACCTGTCTCTCAACGAG -3'

Sequencing Primer
(F):5'- GAGCACATCTCTTTGGGTCCAG -3'
(R):5'- TCAAGGTGCCTCGTGATGAC -3'
Posted On2018-08-01