Incidental Mutation 'R6720:Col15a1'
ID529528
Institutional Source Beutler Lab
Gene Symbol Col15a1
Ensembl Gene ENSMUSG00000028339
Gene Namecollagen, type XV, alpha 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R6720 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location47208161-47313167 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 47247552 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000099981 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082303] [ENSMUST00000102917]
PDB Structure
MURINE COLLAGEN ALPHA1(XV), ENDOSTATIN DOMAIN [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000082303
SMART Domains Protein: ENSMUSP00000080921
Gene: ENSMUSG00000028339

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
TSPN 40 228 2.53e-56 SMART
LamG 89 227 1.7e-7 SMART
low complexity region 236 251 N/A INTRINSIC
low complexity region 332 344 N/A INTRINSIC
low complexity region 541 567 N/A INTRINSIC
Pfam:Collagen 603 663 1.4e-10 PFAM
Pfam:Collagen 650 719 2.1e-9 PFAM
low complexity region 722 742 N/A INTRINSIC
low complexity region 750 759 N/A INTRINSIC
Pfam:Collagen 782 832 2.7e-10 PFAM
Pfam:Collagen 838 894 5.1e-10 PFAM
low complexity region 965 980 N/A INTRINSIC
low complexity region 1010 1020 N/A INTRINSIC
Pfam:Endostatin 1087 1164 9.3e-15 PFAM
Pfam:Endostatin 1148 1345 1.4e-97 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000102917
SMART Domains Protein: ENSMUSP00000099981
Gene: ENSMUSG00000028339

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
TSPN 40 228 2.53e-56 SMART
LamG 89 227 1.7e-7 SMART
low complexity region 236 251 N/A INTRINSIC
low complexity region 332 344 N/A INTRINSIC
low complexity region 541 567 N/A INTRINSIC
Pfam:Collagen 603 666 5.6e-10 PFAM
Pfam:Collagen 659 720 3.1e-10 PFAM
low complexity region 737 764 N/A INTRINSIC
low complexity region 772 781 N/A INTRINSIC
Pfam:Collagen 804 854 9.5e-10 PFAM
Pfam:Collagen 860 916 1.8e-9 PFAM
low complexity region 987 1002 N/A INTRINSIC
low complexity region 1032 1042 N/A INTRINSIC
low complexity region 1050 1109 N/A INTRINSIC
Pfam:Endostatin 1112 1362 2.8e-102 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124105
Meta Mutation Damage Score 0.9492 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.6%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha chain of type XV collagen, a member of the FACIT collagen family (fibril-associated collagens with interrupted helices). Type XV collagen has a wide tissue distribution but the strongest expression is localized to basement membrane zones so it may function to adhere basement membranes to underlying connective tissue stroma. The proteolytically produced C-terminal fragment of type XV collagen is restin, a potentially antiangiogenic protein that is closely related to endostatin. Mouse studies have shown that collagen XV deficiency is associated with muscle and microvessel deterioration. [provided by RefSeq, May 2013]
PHENOTYPE: Homozygous mutation of this gene results in abnormal muscle cells of variable size (including atrophic and split muscle cells), susceptibility to exercise-induced muscle injury, and abnormalities in heart and skeletal muscle capillary endothelium. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik G A 4: 137,454,686 E51K possibly damaging Het
Abca1 A C 4: 53,083,733 L700R probably damaging Het
Arpc1a C A 5: 145,101,222 probably null Het
Baz2b G T 2: 59,924,890 P241Q probably damaging Het
Cd6 T A 19: 10,794,609 T414S probably benign Het
Ces2b A T 8: 104,836,869 E409D probably benign Het
Cfap54 A G 10: 92,821,119 Y3024H probably benign Het
Chrm1 A G 19: 8,678,548 T206A probably benign Het
Clptm1l T C 13: 73,618,516 W512R probably damaging Het
Cox15 A G 19: 43,736,789 S392P probably damaging Het
Cr2 T C 1: 195,155,200 M1197V probably damaging Het
Ddx60 A G 8: 62,000,689 K1281E probably benign Het
Dnah11 A G 12: 118,045,646 F2094L probably damaging Het
Ear2 T A 14: 44,102,959 C25S probably damaging Het
Ect2l T C 10: 18,140,264 D802G probably damaging Het
Eftud2 G A 11: 102,838,623 Q84* probably null Het
Eif4g3 T A 4: 138,175,832 probably null Het
Ephb2 T C 4: 136,657,502 D866G probably damaging Het
Fam129b T A 2: 32,905,826 V22D probably damaging Het
Farsb A G 1: 78,472,497 M99T probably damaging Het
Foxs1 T A 2: 152,932,720 S138C probably damaging Het
Frem1 T G 4: 83,013,832 S211R probably damaging Het
Gm19410 G A 8: 35,807,576 R1517Q probably benign Het
Gria2 T C 3: 80,802,304 I27M probably benign Het
H2-Q7 A G 17: 35,442,678 E299G probably benign Het
Hao2 T G 3: 98,877,135 I305L probably benign Het
Hectd4 C T 5: 121,307,381 Q122* probably null Het
Hivep1 T A 13: 42,164,284 C2079S probably damaging Het
Hoxb1 C A 11: 96,366,987 Q248K probably damaging Het
Hspb6 A G 7: 30,554,347 D95G probably benign Het
Ighv5-2 T A 12: 113,578,506 R117S probably damaging Het
Ino80d A C 1: 63,058,610 S708R probably damaging Het
Lman1l A G 9: 57,614,072 probably null Het
Mmp15 A G 8: 95,365,314 N51D probably benign Het
Naip1 T C 13: 100,423,077 M1140V probably benign Het
Olfr1053 A G 2: 86,315,065 S74P probably damaging Het
Olfr1373 A G 11: 52,144,693 V279A probably benign Het
Olfr397 A G 11: 73,965,465 N286D probably damaging Het
Olfr890 T A 9: 38,143,153 M1K probably null Het
Pard3b A T 1: 62,159,470 N239I probably damaging Het
Parvb C T 15: 84,297,979 R237W probably damaging Het
Pcdha9 T C 18: 36,998,069 S64P probably damaging Het
Pdcd1 T C 1: 94,041,389 N68S probably benign Het
Pi4ka G T 16: 17,326,052 probably null Het
Plekha4 A T 7: 45,540,886 D359V possibly damaging Het
Serpinb13 A G 1: 106,994,062 I78V probably benign Het
Slc39a7 T A 17: 34,030,108 T269S probably benign Het
Sltm T G 9: 70,573,710 D281E probably damaging Het
Zfp708 T C 13: 67,071,432 Y76C probably damaging Het
Zfp990 T A 4: 145,536,927 V165D possibly damaging Het
Other mutations in Col15a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01154:Col15a1 APN 4 47208450 missense possibly damaging 0.86
IGL01561:Col15a1 APN 4 47312118 missense possibly damaging 0.87
IGL01750:Col15a1 APN 4 47303897 missense probably damaging 1.00
IGL02112:Col15a1 APN 4 47253985 splice site probably benign
IGL02158:Col15a1 APN 4 47300606 unclassified probably null
IGL02268:Col15a1 APN 4 47245380 missense probably damaging 0.99
IGL02325:Col15a1 APN 4 47289364 missense probably damaging 1.00
IGL02583:Col15a1 APN 4 47279866 missense probably benign 0.00
IGL02699:Col15a1 APN 4 47284471 unclassified probably benign
IGL03167:Col15a1 APN 4 47282635 missense probably damaging 0.99
IGL03174:Col15a1 APN 4 47282666 missense probably damaging 0.99
R0119:Col15a1 UTSW 4 47262950 missense probably damaging 0.98
R0299:Col15a1 UTSW 4 47262950 missense probably damaging 0.98
R0499:Col15a1 UTSW 4 47262950 missense probably damaging 0.98
R0567:Col15a1 UTSW 4 47293231 missense possibly damaging 0.89
R0607:Col15a1 UTSW 4 47282654 missense probably damaging 0.99
R0992:Col15a1 UTSW 4 47300491 missense probably damaging 0.96
R1165:Col15a1 UTSW 4 47257275 splice site probably benign
R1191:Col15a1 UTSW 4 47254083 nonsense probably null
R1852:Col15a1 UTSW 4 47299278 critical splice donor site probably null
R2349:Col15a1 UTSW 4 47306742 missense probably damaging 0.99
R2512:Col15a1 UTSW 4 47245868 missense possibly damaging 0.95
R2517:Col15a1 UTSW 4 47208492 missense probably damaging 0.98
R2895:Col15a1 UTSW 4 47312091 missense possibly damaging 0.59
R3688:Col15a1 UTSW 4 47258689 missense probably benign 0.00
R3848:Col15a1 UTSW 4 47289374 missense possibly damaging 0.73
R4430:Col15a1 UTSW 4 47245705 missense probably damaging 1.00
R4587:Col15a1 UTSW 4 47257184 missense probably damaging 1.00
R4793:Col15a1 UTSW 4 47262997 missense possibly damaging 0.83
R4812:Col15a1 UTSW 4 47262479 missense possibly damaging 0.93
R4922:Col15a1 UTSW 4 47258719 missense probably benign
R5233:Col15a1 UTSW 4 47296112 missense possibly damaging 0.74
R5602:Col15a1 UTSW 4 47312087 missense probably damaging 1.00
R5786:Col15a1 UTSW 4 47280865 missense possibly damaging 0.84
R5910:Col15a1 UTSW 4 47289514 missense probably damaging 1.00
R5921:Col15a1 UTSW 4 47300602 missense probably damaging 0.99
R5974:Col15a1 UTSW 4 47258683 missense probably benign 0.02
R5985:Col15a1 UTSW 4 47284507 missense probably damaging 0.99
R6010:Col15a1 UTSW 4 47245630 missense probably benign 0.03
R6791:Col15a1 UTSW 4 47300518 missense probably damaging 1.00
R6855:Col15a1 UTSW 4 47245544 missense probably damaging 1.00
R6965:Col15a1 UTSW 4 47247533 missense probably damaging 0.96
R7201:Col15a1 UTSW 4 47307752 missense possibly damaging 0.92
R7261:Col15a1 UTSW 4 47269088 missense probably benign 0.03
R7273:Col15a1 UTSW 4 47284467 splice site probably null
R7413:Col15a1 UTSW 4 47245431 missense possibly damaging 0.81
R7658:Col15a1 UTSW 4 47245591 missense possibly damaging 0.46
R8032:Col15a1 UTSW 4 47288108 missense unknown
R8075:Col15a1 UTSW 4 47208359 missense probably benign 0.07
R8130:Col15a1 UTSW 4 47312196 missense probably damaging 0.97
Z1177:Col15a1 UTSW 4 47245807 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGTCCCAGGCTGGTTCTTTG -3'
(R):5'- GCCCGAGGAACACCTTATAAG -3'

Sequencing Primer
(F):5'- CCCAGGCTGGTTCTTTGCAATG -3'
(R):5'- CACTCCAAGGAGATGGCTG -3'
Posted On2018-08-01