Incidental Mutation 'R6720:Col15a1'
ID 529528
Institutional Source Beutler Lab
Gene Symbol Col15a1
Ensembl Gene ENSMUSG00000028339
Gene Name collagen, type XV, alpha 1
Synonyms
MMRRC Submission 044838-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.082) question?
Stock # R6720 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 47208161-47313167 bp(+) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 47247552 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000099981 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082303] [ENSMUST00000102917]
AlphaFold O35206
PDB Structure MURINE COLLAGEN ALPHA1(XV), ENDOSTATIN DOMAIN [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000082303
SMART Domains Protein: ENSMUSP00000080921
Gene: ENSMUSG00000028339

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
TSPN 40 228 2.53e-56 SMART
LamG 89 227 1.7e-7 SMART
low complexity region 236 251 N/A INTRINSIC
low complexity region 332 344 N/A INTRINSIC
low complexity region 541 567 N/A INTRINSIC
Pfam:Collagen 603 663 1.4e-10 PFAM
Pfam:Collagen 650 719 2.1e-9 PFAM
low complexity region 722 742 N/A INTRINSIC
low complexity region 750 759 N/A INTRINSIC
Pfam:Collagen 782 832 2.7e-10 PFAM
Pfam:Collagen 838 894 5.1e-10 PFAM
low complexity region 965 980 N/A INTRINSIC
low complexity region 1010 1020 N/A INTRINSIC
Pfam:Endostatin 1087 1164 9.3e-15 PFAM
Pfam:Endostatin 1148 1345 1.4e-97 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000102917
SMART Domains Protein: ENSMUSP00000099981
Gene: ENSMUSG00000028339

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
TSPN 40 228 2.53e-56 SMART
LamG 89 227 1.7e-7 SMART
low complexity region 236 251 N/A INTRINSIC
low complexity region 332 344 N/A INTRINSIC
low complexity region 541 567 N/A INTRINSIC
Pfam:Collagen 603 666 5.6e-10 PFAM
Pfam:Collagen 659 720 3.1e-10 PFAM
low complexity region 737 764 N/A INTRINSIC
low complexity region 772 781 N/A INTRINSIC
Pfam:Collagen 804 854 9.5e-10 PFAM
Pfam:Collagen 860 916 1.8e-9 PFAM
low complexity region 987 1002 N/A INTRINSIC
low complexity region 1032 1042 N/A INTRINSIC
low complexity region 1050 1109 N/A INTRINSIC
Pfam:Endostatin 1112 1362 2.8e-102 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124105
Meta Mutation Damage Score 0.9492 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.6%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha chain of type XV collagen, a member of the FACIT collagen family (fibril-associated collagens with interrupted helices). Type XV collagen has a wide tissue distribution but the strongest expression is localized to basement membrane zones so it may function to adhere basement membranes to underlying connective tissue stroma. The proteolytically produced C-terminal fragment of type XV collagen is restin, a potentially antiangiogenic protein that is closely related to endostatin. Mouse studies have shown that collagen XV deficiency is associated with muscle and microvessel deterioration. [provided by RefSeq, May 2013]
PHENOTYPE: Homozygous mutation of this gene results in abnormal muscle cells of variable size (including atrophic and split muscle cells), susceptibility to exercise-induced muscle injury, and abnormalities in heart and skeletal muscle capillary endothelium. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik G A 4: 137,181,997 (GRCm39) E51K possibly damaging Het
Abca1 A C 4: 53,083,733 (GRCm39) L700R probably damaging Het
Arpc1a C A 5: 145,038,032 (GRCm39) probably null Het
Baz2b G T 2: 59,755,234 (GRCm39) P241Q probably damaging Het
Cd6 T A 19: 10,771,973 (GRCm39) T414S probably benign Het
Ces2b A T 8: 105,563,501 (GRCm39) E409D probably benign Het
Cfap54 A G 10: 92,656,981 (GRCm39) Y3024H probably benign Het
Chrm1 A G 19: 8,655,912 (GRCm39) T206A probably benign Het
Clptm1l T C 13: 73,766,635 (GRCm39) W512R probably damaging Het
Cox15 A G 19: 43,725,228 (GRCm39) S392P probably damaging Het
Cplx3 A G 9: 57,521,355 (GRCm39) probably null Het
Cr2 T C 1: 194,837,508 (GRCm39) M1197V probably damaging Het
Ddx60 A G 8: 62,453,723 (GRCm39) K1281E probably benign Het
Dnah11 A G 12: 118,009,381 (GRCm39) F2094L probably damaging Het
Ear2 T A 14: 44,340,416 (GRCm39) C25S probably damaging Het
Ect2l T C 10: 18,016,012 (GRCm39) D802G probably damaging Het
Eftud2 G A 11: 102,729,449 (GRCm39) Q84* probably null Het
Eif4g3 T A 4: 137,903,143 (GRCm39) probably null Het
Ephb2 T C 4: 136,384,813 (GRCm39) D866G probably damaging Het
Farsb A G 1: 78,449,134 (GRCm39) M99T probably damaging Het
Foxs1 T A 2: 152,774,640 (GRCm39) S138C probably damaging Het
Frem1 T G 4: 82,932,069 (GRCm39) S211R probably damaging Het
Gm19410 G A 8: 36,274,730 (GRCm39) R1517Q probably benign Het
Gria2 T C 3: 80,709,611 (GRCm39) I27M probably benign Het
H2-Q7 A G 17: 35,661,654 (GRCm39) E299G probably benign Het
Hao2 T G 3: 98,784,451 (GRCm39) I305L probably benign Het
Hectd4 C T 5: 121,445,444 (GRCm39) Q122* probably null Het
Hivep1 T A 13: 42,317,760 (GRCm39) C2079S probably damaging Het
Hoxb1 C A 11: 96,257,813 (GRCm39) Q248K probably damaging Het
Hspb6 A G 7: 30,253,772 (GRCm39) D95G probably benign Het
Ighv5-2 T A 12: 113,542,126 (GRCm39) R117S probably damaging Het
Ino80d A C 1: 63,097,769 (GRCm39) S708R probably damaging Het
Mmp15 A G 8: 96,091,942 (GRCm39) N51D probably benign Het
Naip1 T C 13: 100,559,585 (GRCm39) M1140V probably benign Het
Niban2 T A 2: 32,795,838 (GRCm39) V22D probably damaging Het
Or1e1f A G 11: 73,856,291 (GRCm39) N286D probably damaging Het
Or2y8 A G 11: 52,035,520 (GRCm39) V279A probably benign Het
Or8b41 T A 9: 38,054,449 (GRCm39) M1K probably null Het
Or8k21 A G 2: 86,145,409 (GRCm39) S74P probably damaging Het
Pard3b A T 1: 62,198,629 (GRCm39) N239I probably damaging Het
Parvb C T 15: 84,182,180 (GRCm39) R237W probably damaging Het
Pcdha9 T C 18: 37,131,122 (GRCm39) S64P probably damaging Het
Pdcd1 T C 1: 93,969,114 (GRCm39) N68S probably benign Het
Pi4ka G T 16: 17,143,916 (GRCm39) probably null Het
Plekha4 A T 7: 45,190,310 (GRCm39) D359V possibly damaging Het
Serpinb13 A G 1: 106,921,792 (GRCm39) I78V probably benign Het
Slc39a7 T A 17: 34,249,082 (GRCm39) T269S probably benign Het
Sltm T G 9: 70,480,992 (GRCm39) D281E probably damaging Het
Zfp708 T C 13: 67,219,496 (GRCm39) Y76C probably damaging Het
Zfp990 T A 4: 145,263,497 (GRCm39) V165D possibly damaging Het
Other mutations in Col15a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01154:Col15a1 APN 4 47,208,450 (GRCm39) missense possibly damaging 0.86
IGL01561:Col15a1 APN 4 47,312,118 (GRCm39) missense possibly damaging 0.87
IGL01750:Col15a1 APN 4 47,303,897 (GRCm39) missense probably damaging 1.00
IGL02112:Col15a1 APN 4 47,253,985 (GRCm39) splice site probably benign
IGL02158:Col15a1 APN 4 47,300,606 (GRCm39) splice site probably null
IGL02268:Col15a1 APN 4 47,245,380 (GRCm39) missense probably damaging 0.99
IGL02325:Col15a1 APN 4 47,289,364 (GRCm39) missense probably damaging 1.00
IGL02583:Col15a1 APN 4 47,279,866 (GRCm39) missense probably benign 0.00
IGL02699:Col15a1 APN 4 47,284,471 (GRCm39) unclassified probably benign
IGL03167:Col15a1 APN 4 47,282,635 (GRCm39) missense probably damaging 0.99
IGL03174:Col15a1 APN 4 47,282,666 (GRCm39) missense probably damaging 0.99
R0119:Col15a1 UTSW 4 47,262,950 (GRCm39) missense probably damaging 0.98
R0299:Col15a1 UTSW 4 47,262,950 (GRCm39) missense probably damaging 0.98
R0499:Col15a1 UTSW 4 47,262,950 (GRCm39) missense probably damaging 0.98
R0567:Col15a1 UTSW 4 47,293,231 (GRCm39) missense possibly damaging 0.89
R0607:Col15a1 UTSW 4 47,282,654 (GRCm39) missense probably damaging 0.99
R0992:Col15a1 UTSW 4 47,300,491 (GRCm39) missense probably damaging 0.96
R1165:Col15a1 UTSW 4 47,257,275 (GRCm39) splice site probably benign
R1191:Col15a1 UTSW 4 47,254,083 (GRCm39) nonsense probably null
R1852:Col15a1 UTSW 4 47,299,278 (GRCm39) critical splice donor site probably null
R2349:Col15a1 UTSW 4 47,306,742 (GRCm39) missense probably damaging 0.99
R2512:Col15a1 UTSW 4 47,245,868 (GRCm39) missense possibly damaging 0.95
R2517:Col15a1 UTSW 4 47,208,492 (GRCm39) missense probably damaging 0.98
R2895:Col15a1 UTSW 4 47,312,091 (GRCm39) missense possibly damaging 0.59
R3688:Col15a1 UTSW 4 47,258,689 (GRCm39) missense probably benign 0.00
R3848:Col15a1 UTSW 4 47,289,374 (GRCm39) missense possibly damaging 0.73
R4430:Col15a1 UTSW 4 47,245,705 (GRCm39) missense probably damaging 1.00
R4587:Col15a1 UTSW 4 47,257,184 (GRCm39) missense probably damaging 1.00
R4793:Col15a1 UTSW 4 47,262,997 (GRCm39) missense possibly damaging 0.83
R4812:Col15a1 UTSW 4 47,262,479 (GRCm39) missense possibly damaging 0.93
R4922:Col15a1 UTSW 4 47,258,719 (GRCm39) missense probably benign
R5233:Col15a1 UTSW 4 47,296,112 (GRCm39) missense possibly damaging 0.74
R5602:Col15a1 UTSW 4 47,312,087 (GRCm39) missense probably damaging 1.00
R5786:Col15a1 UTSW 4 47,280,865 (GRCm39) missense possibly damaging 0.84
R5910:Col15a1 UTSW 4 47,289,514 (GRCm39) missense probably damaging 1.00
R5921:Col15a1 UTSW 4 47,300,602 (GRCm39) missense probably damaging 0.99
R5974:Col15a1 UTSW 4 47,258,683 (GRCm39) missense probably benign 0.02
R5985:Col15a1 UTSW 4 47,284,507 (GRCm39) missense probably damaging 0.99
R6010:Col15a1 UTSW 4 47,245,630 (GRCm39) missense probably benign 0.03
R6791:Col15a1 UTSW 4 47,300,518 (GRCm39) missense probably damaging 1.00
R6855:Col15a1 UTSW 4 47,245,544 (GRCm39) missense probably damaging 1.00
R6965:Col15a1 UTSW 4 47,247,533 (GRCm39) missense probably damaging 0.96
R7201:Col15a1 UTSW 4 47,307,752 (GRCm39) missense possibly damaging 0.92
R7261:Col15a1 UTSW 4 47,269,088 (GRCm39) missense probably benign 0.03
R7273:Col15a1 UTSW 4 47,284,467 (GRCm39) splice site probably null
R7413:Col15a1 UTSW 4 47,245,431 (GRCm39) missense possibly damaging 0.81
R7658:Col15a1 UTSW 4 47,245,591 (GRCm39) missense possibly damaging 0.46
R8032:Col15a1 UTSW 4 47,288,108 (GRCm39) missense unknown
R8075:Col15a1 UTSW 4 47,208,359 (GRCm39) missense probably benign 0.07
R8130:Col15a1 UTSW 4 47,312,196 (GRCm39) missense probably damaging 0.97
R8536:Col15a1 UTSW 4 47,208,536 (GRCm39) critical splice donor site probably null
R8873:Col15a1 UTSW 4 47,247,552 (GRCm39) critical splice donor site probably null
R8887:Col15a1 UTSW 4 47,287,091 (GRCm39) missense probably damaging 1.00
R9141:Col15a1 UTSW 4 47,288,200 (GRCm39) unclassified probably benign
R9143:Col15a1 UTSW 4 47,288,200 (GRCm39) unclassified probably benign
R9161:Col15a1 UTSW 4 47,288,200 (GRCm39) unclassified probably benign
R9176:Col15a1 UTSW 4 47,288,200 (GRCm39) unclassified probably benign
R9177:Col15a1 UTSW 4 47,288,200 (GRCm39) unclassified probably benign
R9181:Col15a1 UTSW 4 47,288,200 (GRCm39) unclassified probably benign
R9184:Col15a1 UTSW 4 47,288,200 (GRCm39) unclassified probably benign
R9185:Col15a1 UTSW 4 47,288,200 (GRCm39) unclassified probably benign
R9214:Col15a1 UTSW 4 47,288,200 (GRCm39) unclassified probably benign
R9268:Col15a1 UTSW 4 47,288,200 (GRCm39) unclassified probably benign
R9269:Col15a1 UTSW 4 47,288,200 (GRCm39) unclassified probably benign
R9362:Col15a1 UTSW 4 47,288,200 (GRCm39) unclassified probably benign
R9367:Col15a1 UTSW 4 47,245,603 (GRCm39) missense probably damaging 1.00
R9385:Col15a1 UTSW 4 47,300,473 (GRCm39) nonsense probably null
R9391:Col15a1 UTSW 4 47,288,200 (GRCm39) unclassified probably benign
R9392:Col15a1 UTSW 4 47,288,200 (GRCm39) unclassified probably benign
R9419:Col15a1 UTSW 4 47,288,200 (GRCm39) unclassified probably benign
R9421:Col15a1 UTSW 4 47,288,200 (GRCm39) unclassified probably benign
R9422:Col15a1 UTSW 4 47,293,364 (GRCm39) critical splice acceptor site probably null
R9426:Col15a1 UTSW 4 47,288,200 (GRCm39) unclassified probably benign
R9427:Col15a1 UTSW 4 47,288,200 (GRCm39) unclassified probably benign
R9429:Col15a1 UTSW 4 47,310,439 (GRCm39) missense probably damaging 1.00
R9646:Col15a1 UTSW 4 47,257,187 (GRCm39) missense possibly damaging 0.73
R9747:Col15a1 UTSW 4 47,312,208 (GRCm39) missense probably damaging 1.00
Z1177:Col15a1 UTSW 4 47,245,807 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- AGTCCCAGGCTGGTTCTTTG -3'
(R):5'- GCCCGAGGAACACCTTATAAG -3'

Sequencing Primer
(F):5'- CCCAGGCTGGTTCTTTGCAATG -3'
(R):5'- CACTCCAAGGAGATGGCTG -3'
Posted On 2018-08-01