Incidental Mutation 'R6720:Abca1'
ID 529529
Institutional Source Beutler Lab
Gene Symbol Abca1
Ensembl Gene ENSMUSG00000015243
Gene Name ATP-binding cassette, sub-family A member 1
Synonyms ABC1
MMRRC Submission 044838-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6720 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 53030787-53159895 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 53083733 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Arginine at position 700 (L700R)
Ref Sequence ENSEMBL: ENSMUSP00000030010 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030010]
AlphaFold P41233
Predicted Effect probably damaging
Transcript: ENSMUST00000030010
AA Change: L700R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030010
Gene: ENSMUSG00000015243
AA Change: L700R

DomainStartEndE-ValueType
transmembrane domain 25 47 N/A INTRINSIC
Pfam:ABC2_membrane_3 395 841 4.9e-14 PFAM
AAA 925 1122 4.2e-10 SMART
low complexity region 1137 1150 N/A INTRINSIC
Pfam:ABC2_membrane_3 1344 1869 1.7e-53 PFAM
low complexity region 1890 1899 N/A INTRINSIC
AAA 1938 2123 3.04e-7 SMART
low complexity region 2176 2187 N/A INTRINSIC
low complexity region 2222 2237 N/A INTRINSIC
Meta Mutation Damage Score 0.9418 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.6%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. In humans, this protein functions as a cholesterol efflux pump in the cellular lipid removal pathway. Mutations in the human gene have been associated with Tangier's disease and familial high-density lipoprotein deficiency. [provided by RefSeq, Jul 2008]
PHENOTYPE: Many homozygous null mutants die perinatally with placental defects. Survivors show altered steroidogenesis, defective lipid export in Golgi, low serum cholesterol, lipid accumulation in macrophages and lung, reduced fertility and kidney and heart defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik G A 4: 137,181,997 (GRCm39) E51K possibly damaging Het
Arpc1a C A 5: 145,038,032 (GRCm39) probably null Het
Baz2b G T 2: 59,755,234 (GRCm39) P241Q probably damaging Het
Cd6 T A 19: 10,771,973 (GRCm39) T414S probably benign Het
Ces2b A T 8: 105,563,501 (GRCm39) E409D probably benign Het
Cfap54 A G 10: 92,656,981 (GRCm39) Y3024H probably benign Het
Chrm1 A G 19: 8,655,912 (GRCm39) T206A probably benign Het
Clptm1l T C 13: 73,766,635 (GRCm39) W512R probably damaging Het
Col15a1 T A 4: 47,247,552 (GRCm39) probably null Het
Cox15 A G 19: 43,725,228 (GRCm39) S392P probably damaging Het
Cplx3 A G 9: 57,521,355 (GRCm39) probably null Het
Cr2 T C 1: 194,837,508 (GRCm39) M1197V probably damaging Het
Ddx60 A G 8: 62,453,723 (GRCm39) K1281E probably benign Het
Dnah11 A G 12: 118,009,381 (GRCm39) F2094L probably damaging Het
Ear2 T A 14: 44,340,416 (GRCm39) C25S probably damaging Het
Ect2l T C 10: 18,016,012 (GRCm39) D802G probably damaging Het
Eftud2 G A 11: 102,729,449 (GRCm39) Q84* probably null Het
Eif4g3 T A 4: 137,903,143 (GRCm39) probably null Het
Ephb2 T C 4: 136,384,813 (GRCm39) D866G probably damaging Het
Farsb A G 1: 78,449,134 (GRCm39) M99T probably damaging Het
Foxs1 T A 2: 152,774,640 (GRCm39) S138C probably damaging Het
Frem1 T G 4: 82,932,069 (GRCm39) S211R probably damaging Het
Gm19410 G A 8: 36,274,730 (GRCm39) R1517Q probably benign Het
Gria2 T C 3: 80,709,611 (GRCm39) I27M probably benign Het
H2-Q7 A G 17: 35,661,654 (GRCm39) E299G probably benign Het
Hao2 T G 3: 98,784,451 (GRCm39) I305L probably benign Het
Hectd4 C T 5: 121,445,444 (GRCm39) Q122* probably null Het
Hivep1 T A 13: 42,317,760 (GRCm39) C2079S probably damaging Het
Hoxb1 C A 11: 96,257,813 (GRCm39) Q248K probably damaging Het
Hspb6 A G 7: 30,253,772 (GRCm39) D95G probably benign Het
Ighv5-2 T A 12: 113,542,126 (GRCm39) R117S probably damaging Het
Ino80d A C 1: 63,097,769 (GRCm39) S708R probably damaging Het
Mmp15 A G 8: 96,091,942 (GRCm39) N51D probably benign Het
Naip1 T C 13: 100,559,585 (GRCm39) M1140V probably benign Het
Niban2 T A 2: 32,795,838 (GRCm39) V22D probably damaging Het
Or1e1f A G 11: 73,856,291 (GRCm39) N286D probably damaging Het
Or2y8 A G 11: 52,035,520 (GRCm39) V279A probably benign Het
Or8b41 T A 9: 38,054,449 (GRCm39) M1K probably null Het
Or8k21 A G 2: 86,145,409 (GRCm39) S74P probably damaging Het
Pard3b A T 1: 62,198,629 (GRCm39) N239I probably damaging Het
Parvb C T 15: 84,182,180 (GRCm39) R237W probably damaging Het
Pcdha9 T C 18: 37,131,122 (GRCm39) S64P probably damaging Het
Pdcd1 T C 1: 93,969,114 (GRCm39) N68S probably benign Het
Pi4ka G T 16: 17,143,916 (GRCm39) probably null Het
Plekha4 A T 7: 45,190,310 (GRCm39) D359V possibly damaging Het
Serpinb13 A G 1: 106,921,792 (GRCm39) I78V probably benign Het
Slc39a7 T A 17: 34,249,082 (GRCm39) T269S probably benign Het
Sltm T G 9: 70,480,992 (GRCm39) D281E probably damaging Het
Zfp708 T C 13: 67,219,496 (GRCm39) Y76C probably damaging Het
Zfp990 T A 4: 145,263,497 (GRCm39) V165D possibly damaging Het
Other mutations in Abca1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Abca1 APN 4 53,059,255 (GRCm39) critical splice donor site probably null
IGL00778:Abca1 APN 4 53,086,132 (GRCm39) missense probably benign
IGL01013:Abca1 APN 4 53,038,185 (GRCm39) nonsense probably null
IGL01510:Abca1 APN 4 53,143,979 (GRCm39) missense probably damaging 0.97
IGL01608:Abca1 APN 4 53,038,158 (GRCm39) missense probably damaging 1.00
IGL01845:Abca1 APN 4 53,090,297 (GRCm39) missense probably damaging 1.00
IGL02048:Abca1 APN 4 53,069,831 (GRCm39) missense probably damaging 1.00
IGL02249:Abca1 APN 4 53,068,739 (GRCm39) nonsense probably null
IGL02569:Abca1 APN 4 53,034,061 (GRCm39) missense probably damaging 1.00
IGL02622:Abca1 APN 4 53,034,046 (GRCm39) missense probably damaging 0.99
R6720_abca1_529 UTSW 4 53,083,733 (GRCm39) missense probably damaging 1.00
R0042:Abca1 UTSW 4 53,059,245 (GRCm39) splice site probably benign
R0042:Abca1 UTSW 4 53,059,245 (GRCm39) splice site probably benign
R0050:Abca1 UTSW 4 53,069,910 (GRCm39) splice site probably benign
R0107:Abca1 UTSW 4 53,080,834 (GRCm39) missense probably benign 0.00
R0127:Abca1 UTSW 4 53,067,155 (GRCm39) missense probably benign 0.00
R0178:Abca1 UTSW 4 53,081,953 (GRCm39) missense possibly damaging 0.89
R0207:Abca1 UTSW 4 53,086,039 (GRCm39) missense probably damaging 0.97
R0267:Abca1 UTSW 4 53,046,105 (GRCm39) missense probably damaging 1.00
R0269:Abca1 UTSW 4 53,044,228 (GRCm39) missense probably benign
R0586:Abca1 UTSW 4 53,092,860 (GRCm39) missense probably benign 0.00
R0587:Abca1 UTSW 4 53,107,035 (GRCm39) missense probably benign 0.00
R1403:Abca1 UTSW 4 53,059,253 (GRCm39) splice site probably benign
R1404:Abca1 UTSW 4 53,059,253 (GRCm39) splice site probably benign
R1405:Abca1 UTSW 4 53,059,253 (GRCm39) splice site probably benign
R1558:Abca1 UTSW 4 53,092,887 (GRCm39) missense probably null 0.00
R1655:Abca1 UTSW 4 53,050,964 (GRCm39) missense probably benign
R1662:Abca1 UTSW 4 53,090,251 (GRCm39) splice site probably null
R1769:Abca1 UTSW 4 53,074,325 (GRCm39) missense probably damaging 1.00
R1898:Abca1 UTSW 4 53,071,977 (GRCm39) missense probably benign 0.08
R1945:Abca1 UTSW 4 53,061,509 (GRCm39) frame shift probably null
R1966:Abca1 UTSW 4 53,050,409 (GRCm39) missense probably damaging 1.00
R2055:Abca1 UTSW 4 53,069,881 (GRCm39) missense probably benign
R2185:Abca1 UTSW 4 53,089,830 (GRCm39) missense probably benign 0.12
R2202:Abca1 UTSW 4 53,090,291 (GRCm39) missense probably damaging 0.96
R2203:Abca1 UTSW 4 53,090,291 (GRCm39) missense probably damaging 0.96
R2204:Abca1 UTSW 4 53,090,291 (GRCm39) missense probably damaging 0.96
R3056:Abca1 UTSW 4 53,127,626 (GRCm39) missense probably benign
R3849:Abca1 UTSW 4 53,061,481 (GRCm39) splice site probably benign
R3850:Abca1 UTSW 4 53,061,481 (GRCm39) splice site probably benign
R3906:Abca1 UTSW 4 53,067,151 (GRCm39) missense possibly damaging 0.84
R3908:Abca1 UTSW 4 53,067,151 (GRCm39) missense possibly damaging 0.84
R4050:Abca1 UTSW 4 53,044,144 (GRCm39) missense probably damaging 1.00
R4204:Abca1 UTSW 4 53,090,369 (GRCm39) missense probably benign 0.00
R4225:Abca1 UTSW 4 53,085,106 (GRCm39) missense possibly damaging 0.87
R4577:Abca1 UTSW 4 53,062,568 (GRCm39) missense possibly damaging 0.94
R4979:Abca1 UTSW 4 53,085,092 (GRCm39) splice site probably null
R5022:Abca1 UTSW 4 53,041,570 (GRCm39) frame shift probably null
R5168:Abca1 UTSW 4 53,086,070 (GRCm39) missense probably benign
R5363:Abca1 UTSW 4 53,132,963 (GRCm39) missense probably benign 0.00
R5439:Abca1 UTSW 4 53,042,381 (GRCm39) missense possibly damaging 0.55
R5604:Abca1 UTSW 4 53,067,168 (GRCm39) splice site probably null
R5614:Abca1 UTSW 4 53,046,132 (GRCm39) missense probably damaging 1.00
R5810:Abca1 UTSW 4 53,079,631 (GRCm39) missense probably benign
R6001:Abca1 UTSW 4 53,075,555 (GRCm39) missense possibly damaging 0.68
R6151:Abca1 UTSW 4 53,085,261 (GRCm39) missense probably benign
R6185:Abca1 UTSW 4 53,078,089 (GRCm39) missense probably benign 0.31
R6262:Abca1 UTSW 4 53,092,917 (GRCm39) missense probably benign 0.01
R6455:Abca1 UTSW 4 53,042,376 (GRCm39) missense probably damaging 0.98
R6472:Abca1 UTSW 4 53,085,991 (GRCm39) critical splice donor site probably null
R6564:Abca1 UTSW 4 53,034,031 (GRCm39) missense possibly damaging 0.85
R6903:Abca1 UTSW 4 53,143,952 (GRCm39) missense probably benign 0.17
R6960:Abca1 UTSW 4 53,072,924 (GRCm39) missense probably benign 0.00
R7065:Abca1 UTSW 4 53,074,233 (GRCm39) missense probably damaging 0.98
R7142:Abca1 UTSW 4 53,082,050 (GRCm39) missense probably damaging 1.00
R7322:Abca1 UTSW 4 53,067,151 (GRCm39) missense probably damaging 0.97
R7520:Abca1 UTSW 4 53,078,114 (GRCm39) missense probably benign
R7547:Abca1 UTSW 4 53,109,269 (GRCm39) missense probably benign 0.02
R7793:Abca1 UTSW 4 53,042,367 (GRCm39) missense not run
R7863:Abca1 UTSW 4 53,107,179 (GRCm39) missense probably benign
R7877:Abca1 UTSW 4 53,046,135 (GRCm39) missense possibly damaging 0.55
R8010:Abca1 UTSW 4 53,127,600 (GRCm39) missense probably benign
R8058:Abca1 UTSW 4 53,081,954 (GRCm39) missense possibly damaging 0.60
R8181:Abca1 UTSW 4 53,059,303 (GRCm39) missense probably benign 0.21
R8471:Abca1 UTSW 4 53,044,187 (GRCm39) missense probably damaging 1.00
R8774:Abca1 UTSW 4 53,090,358 (GRCm39) missense possibly damaging 0.89
R8774-TAIL:Abca1 UTSW 4 53,090,358 (GRCm39) missense possibly damaging 0.89
R8806:Abca1 UTSW 4 53,084,520 (GRCm39) missense probably benign 0.17
R8841:Abca1 UTSW 4 53,143,925 (GRCm39) splice site probably benign
R9081:Abca1 UTSW 4 53,109,162 (GRCm39) critical splice donor site probably null
R9483:Abca1 UTSW 4 53,060,351 (GRCm39) missense probably benign 0.11
R9532:Abca1 UTSW 4 53,109,284 (GRCm39) missense probably benign
R9621:Abca1 UTSW 4 53,092,918 (GRCm39) missense probably benign 0.00
R9638:Abca1 UTSW 4 53,092,806 (GRCm39) missense probably damaging 0.96
RF005:Abca1 UTSW 4 53,049,125 (GRCm39) missense probably damaging 0.97
RF024:Abca1 UTSW 4 53,049,125 (GRCm39) missense probably damaging 0.97
X0023:Abca1 UTSW 4 53,049,038 (GRCm39) missense possibly damaging 0.91
Z1177:Abca1 UTSW 4 53,086,133 (GRCm39) missense possibly damaging 0.73
Z1177:Abca1 UTSW 4 53,080,799 (GRCm39) missense probably benign 0.01
Z1177:Abca1 UTSW 4 53,079,584 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGCCTCTTCCTCCAGAGAGC -3'
(R):5'- CCAGTTTTCTGCGGGTCATG -3'

Sequencing Primer
(F):5'- TAGCTGCTAACTATCCCAGTGGG -3'
(R):5'- TCATGAGCCGGTCAATGC -3'
Posted On 2018-08-01