Incidental Mutation 'R6720:Abca1'
ID529529
Institutional Source Beutler Lab
Gene Symbol Abca1
Ensembl Gene ENSMUSG00000015243
Gene NameATP-binding cassette, sub-family A (ABC1), member 1
SynonymsABC1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6720 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location53030787-53159895 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 53083733 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 700 (L700R)
Ref Sequence ENSEMBL: ENSMUSP00000030010 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030010]
Predicted Effect probably damaging
Transcript: ENSMUST00000030010
AA Change: L700R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030010
Gene: ENSMUSG00000015243
AA Change: L700R

DomainStartEndE-ValueType
transmembrane domain 25 47 N/A INTRINSIC
Pfam:ABC2_membrane_3 395 841 4.9e-14 PFAM
AAA 925 1122 4.2e-10 SMART
low complexity region 1137 1150 N/A INTRINSIC
Pfam:ABC2_membrane_3 1344 1869 1.7e-53 PFAM
low complexity region 1890 1899 N/A INTRINSIC
AAA 1938 2123 3.04e-7 SMART
low complexity region 2176 2187 N/A INTRINSIC
low complexity region 2222 2237 N/A INTRINSIC
Meta Mutation Damage Score 0.9418 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.6%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. In humans, this protein functions as a cholesterol efflux pump in the cellular lipid removal pathway. Mutations in the human gene have been associated with Tangier's disease and familial high-density lipoprotein deficiency. [provided by RefSeq, Jul 2008]
PHENOTYPE: Many homozygous null mutants die perinatally with placental defects. Survivors show altered steroidogenesis, defective lipid export in Golgi, low serum cholesterol, lipid accumulation in macrophages and lung, reduced fertility and kidney and heart defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik G A 4: 137,454,686 E51K possibly damaging Het
Arpc1a C A 5: 145,101,222 probably null Het
Baz2b G T 2: 59,924,890 P241Q probably damaging Het
Cd6 T A 19: 10,794,609 T414S probably benign Het
Ces2b A T 8: 104,836,869 E409D probably benign Het
Cfap54 A G 10: 92,821,119 Y3024H probably benign Het
Chrm1 A G 19: 8,678,548 T206A probably benign Het
Clptm1l T C 13: 73,618,516 W512R probably damaging Het
Col15a1 T A 4: 47,247,552 probably null Het
Cox15 A G 19: 43,736,789 S392P probably damaging Het
Cr2 T C 1: 195,155,200 M1197V probably damaging Het
Ddx60 A G 8: 62,000,689 K1281E probably benign Het
Dnah11 A G 12: 118,045,646 F2094L probably damaging Het
Ear2 T A 14: 44,102,959 C25S probably damaging Het
Ect2l T C 10: 18,140,264 D802G probably damaging Het
Eftud2 G A 11: 102,838,623 Q84* probably null Het
Eif4g3 T A 4: 138,175,832 probably null Het
Ephb2 T C 4: 136,657,502 D866G probably damaging Het
Fam129b T A 2: 32,905,826 V22D probably damaging Het
Farsb A G 1: 78,472,497 M99T probably damaging Het
Foxs1 T A 2: 152,932,720 S138C probably damaging Het
Frem1 T G 4: 83,013,832 S211R probably damaging Het
Gm19410 G A 8: 35,807,576 R1517Q probably benign Het
Gria2 T C 3: 80,802,304 I27M probably benign Het
H2-Q7 A G 17: 35,442,678 E299G probably benign Het
Hao2 T G 3: 98,877,135 I305L probably benign Het
Hectd4 C T 5: 121,307,381 Q122* probably null Het
Hivep1 T A 13: 42,164,284 C2079S probably damaging Het
Hoxb1 C A 11: 96,366,987 Q248K probably damaging Het
Hspb6 A G 7: 30,554,347 D95G probably benign Het
Ighv5-2 T A 12: 113,578,506 R117S probably damaging Het
Ino80d A C 1: 63,058,610 S708R probably damaging Het
Lman1l A G 9: 57,614,072 probably null Het
Mmp15 A G 8: 95,365,314 N51D probably benign Het
Naip1 T C 13: 100,423,077 M1140V probably benign Het
Olfr1053 A G 2: 86,315,065 S74P probably damaging Het
Olfr1373 A G 11: 52,144,693 V279A probably benign Het
Olfr397 A G 11: 73,965,465 N286D probably damaging Het
Olfr890 T A 9: 38,143,153 M1K probably null Het
Pard3b A T 1: 62,159,470 N239I probably damaging Het
Parvb C T 15: 84,297,979 R237W probably damaging Het
Pcdha9 T C 18: 36,998,069 S64P probably damaging Het
Pdcd1 T C 1: 94,041,389 N68S probably benign Het
Pi4ka G T 16: 17,326,052 probably null Het
Plekha4 A T 7: 45,540,886 D359V possibly damaging Het
Serpinb13 A G 1: 106,994,062 I78V probably benign Het
Slc39a7 T A 17: 34,030,108 T269S probably benign Het
Sltm T G 9: 70,573,710 D281E probably damaging Het
Zfp708 T C 13: 67,071,432 Y76C probably damaging Het
Zfp990 T A 4: 145,536,927 V165D possibly damaging Het
Other mutations in Abca1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Abca1 APN 4 53059255 critical splice donor site probably null
IGL00778:Abca1 APN 4 53086132 missense probably benign
IGL01013:Abca1 APN 4 53038185 nonsense probably null
IGL01510:Abca1 APN 4 53143979 missense probably damaging 0.97
IGL01608:Abca1 APN 4 53038158 missense probably damaging 1.00
IGL01845:Abca1 APN 4 53090297 missense probably damaging 1.00
IGL02048:Abca1 APN 4 53069831 missense probably damaging 1.00
IGL02249:Abca1 APN 4 53068739 nonsense probably null
IGL02569:Abca1 APN 4 53034061 missense probably damaging 1.00
IGL02622:Abca1 APN 4 53034046 missense probably damaging 0.99
R6720_abca1_529 UTSW 4 53083733 missense probably damaging 1.00
R0042:Abca1 UTSW 4 53059245 splice site probably benign
R0042:Abca1 UTSW 4 53059245 splice site probably benign
R0050:Abca1 UTSW 4 53069910 splice site probably benign
R0107:Abca1 UTSW 4 53080834 missense probably benign 0.00
R0127:Abca1 UTSW 4 53067155 missense probably benign 0.00
R0178:Abca1 UTSW 4 53081953 missense possibly damaging 0.89
R0207:Abca1 UTSW 4 53086039 missense probably damaging 0.97
R0267:Abca1 UTSW 4 53046105 missense probably damaging 1.00
R0269:Abca1 UTSW 4 53044228 missense probably benign
R0586:Abca1 UTSW 4 53092860 missense probably benign 0.00
R0587:Abca1 UTSW 4 53107035 missense probably benign 0.00
R1403:Abca1 UTSW 4 53059253 splice site probably benign
R1404:Abca1 UTSW 4 53059253 splice site probably benign
R1405:Abca1 UTSW 4 53059253 splice site probably benign
R1558:Abca1 UTSW 4 53092887 missense probably null 0.00
R1655:Abca1 UTSW 4 53050964 missense probably benign
R1662:Abca1 UTSW 4 53090251 splice site probably null
R1769:Abca1 UTSW 4 53074325 missense probably damaging 1.00
R1898:Abca1 UTSW 4 53071977 missense probably benign 0.08
R1945:Abca1 UTSW 4 53061509 frame shift probably null
R1966:Abca1 UTSW 4 53050409 missense probably damaging 1.00
R2055:Abca1 UTSW 4 53069881 missense probably benign
R2185:Abca1 UTSW 4 53089830 missense probably benign 0.12
R2202:Abca1 UTSW 4 53090291 missense probably damaging 0.96
R2203:Abca1 UTSW 4 53090291 missense probably damaging 0.96
R2204:Abca1 UTSW 4 53090291 missense probably damaging 0.96
R3056:Abca1 UTSW 4 53127626 missense probably benign
R3849:Abca1 UTSW 4 53061481 splice site probably benign
R3850:Abca1 UTSW 4 53061481 splice site probably benign
R3906:Abca1 UTSW 4 53067151 missense possibly damaging 0.84
R3908:Abca1 UTSW 4 53067151 missense possibly damaging 0.84
R4050:Abca1 UTSW 4 53044144 missense probably damaging 1.00
R4204:Abca1 UTSW 4 53090369 missense probably benign 0.00
R4225:Abca1 UTSW 4 53085106 missense possibly damaging 0.87
R4577:Abca1 UTSW 4 53062568 missense possibly damaging 0.94
R4979:Abca1 UTSW 4 53085092 splice site probably null
R5022:Abca1 UTSW 4 53041570 frame shift probably null
R5168:Abca1 UTSW 4 53086070 missense probably benign
R5363:Abca1 UTSW 4 53132963 missense probably benign 0.00
R5439:Abca1 UTSW 4 53042381 missense possibly damaging 0.55
R5604:Abca1 UTSW 4 53067168 splice site probably null
R5614:Abca1 UTSW 4 53046132 missense probably damaging 1.00
R5810:Abca1 UTSW 4 53079631 missense probably benign
R6001:Abca1 UTSW 4 53075555 missense possibly damaging 0.68
R6151:Abca1 UTSW 4 53085261 missense probably benign
R6185:Abca1 UTSW 4 53078089 missense probably benign 0.31
R6262:Abca1 UTSW 4 53092917 missense probably benign 0.01
R6455:Abca1 UTSW 4 53042376 missense probably damaging 0.98
R6472:Abca1 UTSW 4 53085991 critical splice donor site probably null
R6564:Abca1 UTSW 4 53034031 missense possibly damaging 0.85
R6903:Abca1 UTSW 4 53143952 missense probably benign 0.17
R6960:Abca1 UTSW 4 53072924 missense probably benign 0.00
R7065:Abca1 UTSW 4 53074233 missense probably damaging 0.98
R7142:Abca1 UTSW 4 53082050 missense probably damaging 1.00
R7322:Abca1 UTSW 4 53067151 missense probably damaging 0.97
R7520:Abca1 UTSW 4 53078114 missense probably benign
R7547:Abca1 UTSW 4 53109269 missense probably benign 0.02
R7793:Abca1 UTSW 4 53042367 missense not run
RF005:Abca1 UTSW 4 53049125 missense probably damaging 0.97
RF024:Abca1 UTSW 4 53049125 missense probably damaging 0.97
X0023:Abca1 UTSW 4 53049038 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- AGCCTCTTCCTCCAGAGAGC -3'
(R):5'- CCAGTTTTCTGCGGGTCATG -3'

Sequencing Primer
(F):5'- TAGCTGCTAACTATCCCAGTGGG -3'
(R):5'- TCATGAGCCGGTCAATGC -3'
Posted On2018-08-01