Mutagenetix > Incidental Mutations

Incidental Mutation 'R6720:Ephb2'

529531

Institutional Source

Beutler Lab

Gene Symbol

Ephb2

Ensembl Gene

ENSMUSG00000028664

Gene Name

Eph receptor B2

Synonyms

Erk, eteck, Tyro5, Prkm5, Drt, Hek5, Sek3, Qek5, Cek5, Nuk

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.763) question?

Stock #

R6720 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

136647539-136835988 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 136657502 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 866 (D866G)

Ref Sequence

ENSEMBL: ENSMUSP00000101471 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000059287] [ENSMUST00000105845] [ENSMUST00000105846]

Predicted Effect

probably damaging
Transcript: ENSMUST00000059287
AA Change: D867G

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000058135
Gene: ENSMUSG00000028664
AA Change: D867G

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
EPH_lbd	20	197	7.37e-130	SMART
Pfam:GCC2_GCC3	261	304	8.1e-10	PFAM
FN3	325	417	1.75e-6	SMART
FN3	436	518	1.23e-10	SMART
Pfam:EphA2_TM	545	619	6e-25	PFAM
TyrKc	622	881	1.34e-138	SMART
SAM	911	978	1.18e-23	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000105845
AA Change: D866G

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000101471
Gene: ENSMUSG00000028664
AA Change: D866G

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
EPH_lbd	20	197	7.37e-130	SMART
Pfam:GCC2_GCC3	259	305	2.2e-10	PFAM
FN3	325	417	1.75e-6	SMART
FN3	436	517	1.41e-10	SMART
Pfam:EphA2_TM	543	618	2.1e-30	PFAM
TyrKc	621	880	1.34e-138	SMART
SAM	910	977	1.18e-23	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000105846
AA Change: D867G

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000101472
Gene: ENSMUSG00000028664
AA Change: D867G

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
EPH_lbd	20	197	7.37e-130	SMART
Pfam:GCC2_GCC3	259	305	2.2e-10	PFAM
FN3	325	417	1.75e-6	SMART
FN3	436	517	1.41e-10	SMART
Pfam:EphA2_TM	543	619	1e-30	PFAM
TyrKc	622	881	1.34e-138	SMART
SAM	911	978	1.18e-23	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000151502

Predicted Effect

probably benign
Transcript: ENSMUST00000156558

SMART Domains

Protein: ENSMUSP00000116350
Gene: ENSMUSG00000028664

Domain	Start	End	E-Value	Type
FN3	1	85	6.48e1	SMART
FN3	104	186	1.23e-10	SMART
Pfam:EphA2_TM	213	276	2.5e-16	PFAM

Meta Mutation Damage Score

0.5784

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.7%
20x: 93.6%

Validation Efficiency

98% (50/51)

MGI Phenotype

FUNCTION: This gene encodes a member of the Eph receptor family of receptor tyrosine kinase transmembrane glycoproteins. These receptors consist of an N-terminal glycosylated ligand-binding domain, a transmembrane region and an intracellular kinase domain. The encoded receptor preferentially binds membrane-bound ephrin-B ligands and is involved in nervous system and vascular development. This gene is used as a marker of intestinal stem cells. Homozygous knockout mice for this gene exhibit impaired axon guidance and vestibular function. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit abnormal axon guidance, circling, head bobbing, and hyperactivity. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700013G24Rik	G	A	4: 137,454,686	E51K	possibly damaging	Het
Abca1	A	C	4: 53,083,733	L700R	probably damaging	Het
Arpc1a	C	A	5: 145,101,222		probably null	Het
Baz2b	G	T	2: 59,924,890	P241Q	probably damaging	Het
Cd6	T	A	19: 10,794,609	T414S	probably benign	Het
Ces2b	A	T	8: 104,836,869	E409D	probably benign	Het
Cfap54	A	G	10: 92,821,119	Y3024H	probably benign	Het
Chrm1	A	G	19: 8,678,548	T206A	probably benign	Het
Clptm1l	T	C	13: 73,618,516	W512R	probably damaging	Het
Col15a1	T	A	4: 47,247,552		probably null	Het
Cox15	A	G	19: 43,736,789	S392P	probably damaging	Het
Cr2	T	C	1: 195,155,200	M1197V	probably damaging	Het
Ddx60	A	G	8: 62,000,689	K1281E	probably benign	Het
Dnah11	A	G	12: 118,045,646	F2094L	probably damaging	Het
Ear2	T	A	14: 44,102,959	C25S	probably damaging	Het
Ect2l	T	C	10: 18,140,264	D802G	probably damaging	Het
Eftud2	G	A	11: 102,838,623	Q84*	probably null	Het
Eif4g3	T	A	4: 138,175,832		probably null	Het
Fam129b	T	A	2: 32,905,826	V22D	probably damaging	Het
Farsb	A	G	1: 78,472,497	M99T	probably damaging	Het
Foxs1	T	A	2: 152,932,720	S138C	probably damaging	Het
Frem1	T	G	4: 83,013,832	S211R	probably damaging	Het
Gm19410	G	A	8: 35,807,576	R1517Q	probably benign	Het
Gria2	T	C	3: 80,802,304	I27M	probably benign	Het
H2-Q7	A	G	17: 35,442,678	E299G	probably benign	Het
Hao2	T	G	3: 98,877,135	I305L	probably benign	Het
Hectd4	C	T	5: 121,307,381	Q122*	probably null	Het
Hivep1	T	A	13: 42,164,284	C2079S	probably damaging	Het
Hoxb1	C	A	11: 96,366,987	Q248K	probably damaging	Het
Hspb6	A	G	7: 30,554,347	D95G	probably benign	Het
Ighv5-2	T	A	12: 113,578,506	R117S	probably damaging	Het
Ino80d	A	C	1: 63,058,610	S708R	probably damaging	Het
Lman1l	A	G	9: 57,614,072		probably null	Het
Mmp15	A	G	8: 95,365,314	N51D	probably benign	Het
Naip1	T	C	13: 100,423,077	M1140V	probably benign	Het
Olfr1053	A	G	2: 86,315,065	S74P	probably damaging	Het
Olfr1373	A	G	11: 52,144,693	V279A	probably benign	Het
Olfr397	A	G	11: 73,965,465	N286D	probably damaging	Het
Olfr890	T	A	9: 38,143,153	M1K	probably null	Het
Pard3b	A	T	1: 62,159,470	N239I	probably damaging	Het
Parvb	C	T	15: 84,297,979	R237W	probably damaging	Het
Pcdha9	T	C	18: 36,998,069	S64P	probably damaging	Het
Pdcd1	T	C	1: 94,041,389	N68S	probably benign	Het
Pi4ka	G	T	16: 17,326,052		probably null	Het
Plekha4	A	T	7: 45,540,886	D359V	possibly damaging	Het
Serpinb13	A	G	1: 106,994,062	I78V	probably benign	Het
Slc39a7	T	A	17: 34,030,108	T269S	probably benign	Het
Sltm	T	G	9: 70,573,710	D281E	probably damaging	Het
Zfp708	T	C	13: 67,071,432	Y76C	probably damaging	Het
Zfp990	T	A	4: 145,536,927	V165D	possibly damaging	Het

Other mutations in Ephb2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00336:Ephb2	APN	4	136657484	missense	probably damaging	0.96
IGL00963:Ephb2	APN	4	136658951	missense	probably benign	0.04
IGL01111:Ephb2	APN	4	136657410	missense	probably benign	0.01
IGL01462:Ephb2	APN	4	136771370	missense	possibly damaging	0.61
IGL01863:Ephb2	APN	4	136659777	missense	probably benign	0.03
IGL02149:Ephb2	APN	4	136693914	missense	probably damaging	1.00
IGL02232:Ephb2	APN	4	136657451	missense	probably damaging	0.97
IGL02269:Ephb2	APN	4	136771049	missense	possibly damaging	0.66
IGL02828:Ephb2	APN	4	136771150	missense	probably benign	0.09
IGL03109:Ephb2	APN	4	136771544	missense	probably damaging	1.00
IGL03284:Ephb2	APN	4	136661516	missense	probably damaging	0.96
PIT4453001:Ephb2	UTSW	4	136660810	missense	probably benign	0.00
R0004:Ephb2	UTSW	4	136657524	missense	probably damaging	1.00
R0121:Ephb2	UTSW	4	136771057	missense	probably damaging	0.99
R0539:Ephb2	UTSW	4	136655976	missense	probably damaging	1.00
R0614:Ephb2	UTSW	4	136673365	missense	probably benign	0.00
R0988:Ephb2	UTSW	4	136659708	missense	possibly damaging	0.59
R1471:Ephb2	UTSW	4	136658951	missense	probably benign	0.04
R1473:Ephb2	UTSW	4	136694058	missense	possibly damaging	0.83
R1546:Ephb2	UTSW	4	136771009	missense	probably damaging	0.99
R1639:Ephb2	UTSW	4	136693905	missense	probably benign	0.10
R1725:Ephb2	UTSW	4	136659778	nonsense	probably null
R1779:Ephb2	UTSW	4	136693825	missense	possibly damaging	0.64
R1818:Ephb2	UTSW	4	136655336	missense	probably benign	0.02
R2099:Ephb2	UTSW	4	136660755	missense	probably damaging	1.00
R2916:Ephb2	UTSW	4	136683945	missense	probably damaging	0.99
R3885:Ephb2	UTSW	4	136771034	missense	probably damaging	1.00
R4572:Ephb2	UTSW	4	136655940	missense	probably damaging	1.00
R4709:Ephb2	UTSW	4	136696052	missense	probably damaging	1.00
R4893:Ephb2	UTSW	4	136659753	missense	probably damaging	0.99
R4981:Ephb2	UTSW	4	136696010	missense	probably benign	0.09
R4992:Ephb2	UTSW	4	136660839	missense	probably damaging	1.00
R5004:Ephb2	UTSW	4	136659699	missense	possibly damaging	0.77
R5307:Ephb2	UTSW	4	136693787	missense	possibly damaging	0.89
R5370:Ephb2	UTSW	4	136771570	missense	probably benign	0.00
R5561:Ephb2	UTSW	4	136661406	missense	probably damaging	1.00
R5643:Ephb2	UTSW	4	136771612	missense	probably damaging	0.99
R5826:Ephb2	UTSW	4	136660737	missense	probably damaging	1.00
R5858:Ephb2	UTSW	4	136672445	missense	probably benign
R5867:Ephb2	UTSW	4	136675422	missense	possibly damaging	0.81
R5990:Ephb2	UTSW	4	136696055	missense	probably benign	0.03
R6000:Ephb2	UTSW	4	136684030	missense	possibly damaging	0.76
R6156:Ephb2	UTSW	4	136661505	missense	probably benign	0.44
R6413:Ephb2	UTSW	4	136771122	missense	probably benign	0.08
R6577:Ephb2	UTSW	4	136657550	missense	probably damaging	0.99
R6633:Ephb2	UTSW	4	136683996	missense	probably benign	0.07
R6795:Ephb2	UTSW	4	136673335	missense	possibly damaging	0.88
R7235:Ephb2	UTSW	4	136693828	missense	probably damaging	1.00
R7260:Ephb2	UTSW	4	136771574	missense	probably damaging	0.96
R7328:Ephb2	UTSW	4	136658934	critical splice donor site	probably null
R7404:Ephb2	UTSW	4	136771213	missense	probably damaging	1.00
R7466:Ephb2	UTSW	4	136659065	missense	probably damaging	1.00
R7524:Ephb2	UTSW	4	136659709	missense	probably damaging	1.00
R7605:Ephb2	UTSW	4	136771108	missense	probably damaging	1.00
R7611:Ephb2	UTSW	4	136660901	critical splice acceptor site	probably null
R7777:Ephb2	UTSW	4	136771636	missense	possibly damaging	0.92
R7889:Ephb2	UTSW	4	136771042	missense	probably damaging	0.99
R7972:Ephb2	UTSW	4	136771042	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- ACCATCCCAGACTGCCATTG -3'
(R):5'- CTCCAGAGATGAATATGCTCAGCAG -3'

Sequencing Primer
(F):5'- TCCAGGATGGCACCCAGAG -3'
(R):5'- AACGCCATTGAACAGGAC -3'

Posted On

2018-08-01