Incidental Mutation 'R6720:Eif4g3'
ID529533
Institutional Source Beutler Lab
Gene Symbol Eif4g3
Ensembl Gene ENSMUSG00000028760
Gene Nameeukaryotic translation initiation factor 4 gamma, 3
Synonyms1500002J22Rik, repro8, G1-419-52, 4930523M17Rik, eIF4GII
MMRRC Submission
Accession Numbers

Genbank: NM_172703; MGI: 1923935

Is this an essential gene? Possibly non essential (E-score: 0.400) question?
Stock #R6720 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location137993022-138208508 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to A at 138175832 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000145147 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084214] [ENSMUST00000084215] [ENSMUST00000105831] [ENSMUST00000140796] [ENSMUST00000203828]
Predicted Effect probably null
Transcript: ENSMUST00000084214
SMART Domains Protein: ENSMUSP00000081232
Gene: ENSMUSG00000028760

DomainStartEndE-ValueType
low complexity region 24 43 N/A INTRINSIC
low complexity region 93 120 N/A INTRINSIC
low complexity region 147 152 N/A INTRINSIC
PDB:1LJ2|D 154 179 8e-9 PDB
low complexity region 192 207 N/A INTRINSIC
low complexity region 269 310 N/A INTRINSIC
low complexity region 427 444 N/A INTRINSIC
low complexity region 534 550 N/A INTRINSIC
low complexity region 579 588 N/A INTRINSIC
low complexity region 592 616 N/A INTRINSIC
Blast:MIF4G 617 708 5e-49 BLAST
Blast:MIF4G 722 765 5e-16 BLAST
MIF4G 768 996 1.42e-65 SMART
low complexity region 1086 1109 N/A INTRINSIC
MA3 1215 1327 9.29e-38 SMART
eIF5C 1487 1574 7.92e-36 SMART
Predicted Effect probably null
Transcript: ENSMUST00000084215
SMART Domains Protein: ENSMUSP00000081233
Gene: ENSMUSG00000028760

DomainStartEndE-ValueType
low complexity region 10 25 N/A INTRINSIC
low complexity region 75 102 N/A INTRINSIC
low complexity region 129 134 N/A INTRINSIC
PDB:1LJ2|D 136 161 8e-9 PDB
low complexity region 174 189 N/A INTRINSIC
low complexity region 251 292 N/A INTRINSIC
low complexity region 409 426 N/A INTRINSIC
low complexity region 516 532 N/A INTRINSIC
low complexity region 561 570 N/A INTRINSIC
low complexity region 574 598 N/A INTRINSIC
Blast:MIF4G 599 690 4e-49 BLAST
Blast:MIF4G 704 747 5e-16 BLAST
MIF4G 750 978 1.42e-65 SMART
low complexity region 1068 1113 N/A INTRINSIC
MA3 1216 1328 9.29e-38 SMART
eIF5C 1488 1575 7.92e-36 SMART
Predicted Effect probably null
Transcript: ENSMUST00000105831
SMART Domains Protein: ENSMUSP00000101457
Gene: ENSMUSG00000028760

DomainStartEndE-ValueType
low complexity region 14 32 N/A INTRINSIC
low complexity region 82 109 N/A INTRINSIC
low complexity region 136 141 N/A INTRINSIC
PDB:1LJ2|D 143 168 8e-9 PDB
low complexity region 181 196 N/A INTRINSIC
low complexity region 258 299 N/A INTRINSIC
low complexity region 416 433 N/A INTRINSIC
low complexity region 523 539 N/A INTRINSIC
low complexity region 568 577 N/A INTRINSIC
low complexity region 581 605 N/A INTRINSIC
Blast:MIF4G 606 697 4e-49 BLAST
Blast:MIF4G 711 754 5e-16 BLAST
MIF4G 757 985 1.42e-65 SMART
low complexity region 1075 1098 N/A INTRINSIC
MA3 1204 1316 9.29e-38 SMART
eIF5C 1476 1563 7.92e-36 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133902
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135745
Predicted Effect probably null
Transcript: ENSMUST00000140796
SMART Domains Protein: ENSMUSP00000115946
Gene: ENSMUSG00000028760

DomainStartEndE-ValueType
low complexity region 3 12 N/A INTRINSIC
low complexity region 16 40 N/A INTRINSIC
Blast:MIF4G 41 132 2e-49 BLAST
Blast:MIF4G 146 189 3e-16 BLAST
MIF4G 192 420 1.42e-65 SMART
low complexity region 510 533 N/A INTRINSIC
MA3 639 751 9.29e-38 SMART
eIF5C 911 998 7.92e-36 SMART
Predicted Effect probably null
Transcript: ENSMUST00000203828
SMART Domains Protein: ENSMUSP00000145147
Gene: ENSMUSG00000028760

DomainStartEndE-ValueType
low complexity region 41 81 N/A INTRINSIC
low complexity region 193 208 N/A INTRINSIC
low complexity region 258 285 N/A INTRINSIC
low complexity region 312 317 N/A INTRINSIC
PDB:1LJ2|D 319 344 9e-9 PDB
low complexity region 357 372 N/A INTRINSIC
low complexity region 434 475 N/A INTRINSIC
low complexity region 592 609 N/A INTRINSIC
low complexity region 699 715 N/A INTRINSIC
low complexity region 744 753 N/A INTRINSIC
low complexity region 757 781 N/A INTRINSIC
Blast:MIF4G 782 873 9e-49 BLAST
Blast:MIF4G 887 930 5e-16 BLAST
MIF4G 933 1161 6e-68 SMART
coiled coil region 1174 1201 N/A INTRINSIC
low complexity region 1251 1296 N/A INTRINSIC
MA3 1399 1511 3.9e-40 SMART
eIF5C 1671 1758 3.9e-38 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.6%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is thought to be part of the eIF4F protein complex, which is involved in mRNA cap recognition and transport of mRNAs to the ribosome. Interestingly, a microRNA (miR-520c-3p) has been found that negatively regulates synthesis of the encoded protein, and this leads to a global decrease in protein translation and cell proliferation. Therefore, this protein is a key component of the anti-tumor activity of miR-520c-3p. [provided by RefSeq, May 2016]
PHENOTYPE: Mice homozygous for an ENU induced allele exhibit decreased testes weight, azoospermia, and arrested male meiosis. Mice homozygous for a gene trapped allele exhibit small testes. [provided by MGI curators]
Allele List at MGI

All alleles(27) : Gene trapped(27)

Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik G A 4: 137,454,686 E51K possibly damaging Het
Abca1 A C 4: 53,083,733 L700R probably damaging Het
Arpc1a C A 5: 145,101,222 probably null Het
Baz2b G T 2: 59,924,890 P241Q probably damaging Het
Cd6 T A 19: 10,794,609 T414S probably benign Het
Ces2b A T 8: 104,836,869 E409D probably benign Het
Cfap54 A G 10: 92,821,119 Y3024H probably benign Het
Chrm1 A G 19: 8,678,548 T206A probably benign Het
Clptm1l T C 13: 73,618,516 W512R probably damaging Het
Col15a1 T A 4: 47,247,552 probably null Het
Cox15 A G 19: 43,736,789 S392P probably damaging Het
Cr2 T C 1: 195,155,200 M1197V probably damaging Het
Ddx60 A G 8: 62,000,689 K1281E probably benign Het
Dnah11 A G 12: 118,045,646 F2094L probably damaging Het
Ear2 T A 14: 44,102,959 C25S probably damaging Het
Ect2l T C 10: 18,140,264 D802G probably damaging Het
Eftud2 G A 11: 102,838,623 Q84* probably null Het
Ephb2 T C 4: 136,657,502 D866G probably damaging Het
Fam129b T A 2: 32,905,826 V22D probably damaging Het
Farsb A G 1: 78,472,497 M99T probably damaging Het
Foxs1 T A 2: 152,932,720 S138C probably damaging Het
Frem1 T G 4: 83,013,832 S211R probably damaging Het
Gm19410 G A 8: 35,807,576 R1517Q probably benign Het
Gria2 T C 3: 80,802,304 I27M probably benign Het
H2-Q7 A G 17: 35,442,678 E299G probably benign Het
Hao2 T G 3: 98,877,135 I305L probably benign Het
Hectd4 C T 5: 121,307,381 Q122* probably null Het
Hivep1 T A 13: 42,164,284 C2079S probably damaging Het
Hoxb1 C A 11: 96,366,987 Q248K probably damaging Het
Hspb6 A G 7: 30,554,347 D95G probably benign Het
Ighv5-2 T A 12: 113,578,506 R117S probably damaging Het
Ino80d A C 1: 63,058,610 S708R probably damaging Het
Lman1l A G 9: 57,614,072 probably null Het
Mmp15 A G 8: 95,365,314 N51D probably benign Het
Naip1 T C 13: 100,423,077 M1140V probably benign Het
Olfr1053 A G 2: 86,315,065 S74P probably damaging Het
Olfr1373 A G 11: 52,144,693 V279A probably benign Het
Olfr397 A G 11: 73,965,465 N286D probably damaging Het
Olfr890 T A 9: 38,143,153 M1K probably null Het
Pard3b A T 1: 62,159,470 N239I probably damaging Het
Parvb C T 15: 84,297,979 R237W probably damaging Het
Pcdha9 T C 18: 36,998,069 S64P probably damaging Het
Pdcd1 T C 1: 94,041,389 N68S probably benign Het
Pi4ka G T 16: 17,326,052 probably null Het
Plekha4 A T 7: 45,540,886 D359V possibly damaging Het
Serpinb13 A G 1: 106,994,062 I78V probably benign Het
Slc39a7 T A 17: 34,030,108 T269S probably benign Het
Sltm T G 9: 70,573,710 D281E probably damaging Het
Zfp708 T C 13: 67,071,432 Y76C probably damaging Het
Zfp990 T A 4: 145,536,927 V165D possibly damaging Het
Other mutations in Eif4g3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01817:Eif4g3 APN 4 138120362 missense probably benign 0.01
IGL02171:Eif4g3 APN 4 138126589 missense probably benign 0.03
IGL02487:Eif4g3 APN 4 138203378 missense possibly damaging 0.92
IGL02514:Eif4g3 APN 4 138126194 missense possibly damaging 0.87
IGL02622:Eif4g3 APN 4 138097366 splice site probably benign
IGL02725:Eif4g3 APN 4 138170471 splice site probably benign
IGL02735:Eif4g3 APN 4 138126211 missense probably benign 0.40
IGL03008:Eif4g3 APN 4 138120388 missense probably damaging 1.00
IGL03077:Eif4g3 APN 4 138125855 missense probably damaging 1.00
N/A - 535:Eif4g3 UTSW 4 138120428 missense probably damaging 0.98
R0013:Eif4g3 UTSW 4 138175848 missense possibly damaging 0.88
R0193:Eif4g3 UTSW 4 138146376 splice site probably benign
R0240:Eif4g3 UTSW 4 138170562 missense probably damaging 0.98
R0240:Eif4g3 UTSW 4 138170562 missense probably damaging 0.98
R0563:Eif4g3 UTSW 4 138175840 splice site probably benign
R0841:Eif4g3 UTSW 4 138165818 missense probably damaging 1.00
R0884:Eif4g3 UTSW 4 138151776 missense possibly damaging 0.76
R1116:Eif4g3 UTSW 4 138091775 critical splice donor site probably null
R1145:Eif4g3 UTSW 4 138165818 missense probably damaging 1.00
R1145:Eif4g3 UTSW 4 138165818 missense probably damaging 1.00
R1192:Eif4g3 UTSW 4 138171186 missense probably damaging 1.00
R1401:Eif4g3 UTSW 4 138206084 missense probably damaging 0.99
R1535:Eif4g3 UTSW 4 138097302 missense probably damaging 1.00
R1571:Eif4g3 UTSW 4 138120408 missense probably damaging 1.00
R1576:Eif4g3 UTSW 4 138096870 missense probably damaging 0.99
R1607:Eif4g3 UTSW 4 138126563 missense probably benign 0.00
R1618:Eif4g3 UTSW 4 138206058 missense probably damaging 1.00
R1793:Eif4g3 UTSW 4 138171131 missense probably damaging 1.00
R1823:Eif4g3 UTSW 4 138180491 missense probably benign 0.37
R1857:Eif4g3 UTSW 4 138175876 missense possibly damaging 0.67
R1907:Eif4g3 UTSW 4 138158415 missense probably damaging 1.00
R2041:Eif4g3 UTSW 4 138105306 splice site probably benign
R2106:Eif4g3 UTSW 4 138082919 start gained probably benign
R2124:Eif4g3 UTSW 4 138184742 missense probably damaging 1.00
R2301:Eif4g3 UTSW 4 138172659 missense probably damaging 1.00
R2519:Eif4g3 UTSW 4 138097318 missense probably benign 0.37
R3033:Eif4g3 UTSW 4 138103410 missense probably damaging 1.00
R3870:Eif4g3 UTSW 4 138096900 missense probably damaging 0.98
R4542:Eif4g3 UTSW 4 138203417 missense probably damaging 0.99
R4582:Eif4g3 UTSW 4 138171245 missense probably damaging 1.00
R4607:Eif4g3 UTSW 4 138126458 missense probably benign 0.03
R4608:Eif4g3 UTSW 4 138126458 missense probably benign 0.03
R4658:Eif4g3 UTSW 4 138206132 missense probably damaging 1.00
R4736:Eif4g3 UTSW 4 138198097 missense probably benign 0.01
R4739:Eif4g3 UTSW 4 138183199 missense possibly damaging 0.79
R4739:Eif4g3 UTSW 4 138198097 missense probably benign 0.01
R4740:Eif4g3 UTSW 4 138198097 missense probably benign 0.01
R4760:Eif4g3 UTSW 4 138084318 missense possibly damaging 0.46
R4825:Eif4g3 UTSW 4 138194081 missense probably benign
R4826:Eif4g3 UTSW 4 138177945 missense possibly damaging 0.95
R4941:Eif4g3 UTSW 4 138170565 missense probably damaging 1.00
R5040:Eif4g3 UTSW 4 138096889 missense probably damaging 0.99
R5070:Eif4g3 UTSW 4 138146299 missense probably benign 0.00
R5155:Eif4g3 UTSW 4 138126743 missense probably benign 0.36
R5226:Eif4g3 UTSW 4 138096794 missense possibly damaging 0.93
R5229:Eif4g3 UTSW 4 138096794 missense possibly damaging 0.93
R5303:Eif4g3 UTSW 4 138126562 missense probably benign 0.04
R5369:Eif4g3 UTSW 4 138183334 missense possibly damaging 0.87
R5394:Eif4g3 UTSW 4 138103398 unclassified probably null
R5665:Eif4g3 UTSW 4 138126589 missense probably benign 0.03
R5678:Eif4g3 UTSW 4 138151742 missense probably damaging 0.99
R5695:Eif4g3 UTSW 4 138163433 splice site probably null
R5704:Eif4g3 UTSW 4 138190692 missense probably damaging 1.00
R5924:Eif4g3 UTSW 4 138201926 missense probably damaging 1.00
R6214:Eif4g3 UTSW 4 138058003 missense probably damaging 0.99
R6278:Eif4g3 UTSW 4 138188083 missense possibly damaging 0.82
R6519:Eif4g3 UTSW 4 137994008 missense probably benign
R6659:Eif4g3 UTSW 4 138177932 missense probably damaging 1.00
R6812:Eif4g3 UTSW 4 138103376 missense probably damaging 1.00
R6922:Eif4g3 UTSW 4 138097335 missense probably damaging 1.00
R7175:Eif4g3 UTSW 4 138126215 missense probably damaging 1.00
R7176:Eif4g3 UTSW 4 138171186 missense probably damaging 1.00
R7598:Eif4g3 UTSW 4 138194124 missense probably benign 0.02
R7618:Eif4g3 UTSW 4 138171118 missense probably damaging 1.00
R7805:Eif4g3 UTSW 4 138146354 missense probably benign 0.00
R7935:Eif4g3 UTSW 4 138096771 missense probably damaging 1.00
R7983:Eif4g3 UTSW 4 138151593 missense probably benign 0.00
R8261:Eif4g3 UTSW 4 138171118 missense possibly damaging 0.46
R8371:Eif4g3 UTSW 4 138096845 missense probably damaging 1.00
RF008:Eif4g3 UTSW 4 138175924 missense probably damaging 0.98
X0067:Eif4g3 UTSW 4 138163619 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GTTTATGCAGTGGAAAAGTAGACGC -3'
(R):5'- GACACACTGTAGGATGGAGC -3'

Sequencing Primer
(F):5'- CCTCCTGTGTACTGGGACTAAAG -3'
(R):5'- AGCACTTGCCTAGCAGTCC -3'
Posted On2018-08-01