Mutagenetix > Incidental Mutation

Incidental Mutation 'R6720:Eif4g3'

529533

Institutional Source

Beutler Lab

Gene Symbol

Eif4g3

Ensembl Gene

ENSMUSG00000028760

Gene Name

eukaryotic translation initiation factor 4 gamma, 3

Synonyms

1500002J22Rik, repro8, G1-419-52, 4930523M17Rik, eIF4GII

MMRRC Submission

Accession Numbers

Genbank: NM_172703; MGI: 1923935

Is this an essential gene?

Probably non essential (E-score: 0.173) question?

Stock #

R6720 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

137993022-138208508 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to A at 138175832 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000145147 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000084214] [ENSMUST00000084215] [ENSMUST00000105831] [ENSMUST00000140796] [ENSMUST00000203828]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000084214

SMART Domains

Protein: ENSMUSP00000081232
Gene: ENSMUSG00000028760

Domain	Start	End	E-Value	Type
low complexity region	24	43	N/A	INTRINSIC
low complexity region	93	120	N/A	INTRINSIC
low complexity region	147	152	N/A	INTRINSIC
PDB:1LJ2\|D	154	179	8e-9	PDB
low complexity region	192	207	N/A	INTRINSIC
low complexity region	269	310	N/A	INTRINSIC
low complexity region	427	444	N/A	INTRINSIC
low complexity region	534	550	N/A	INTRINSIC
low complexity region	579	588	N/A	INTRINSIC
low complexity region	592	616	N/A	INTRINSIC
Blast:MIF4G	617	708	5e-49	BLAST
Blast:MIF4G	722	765	5e-16	BLAST
MIF4G	768	996	1.42e-65	SMART
low complexity region	1086	1109	N/A	INTRINSIC
MA3	1215	1327	9.29e-38	SMART
eIF5C	1487	1574	7.92e-36	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000084215

SMART Domains

Protein: ENSMUSP00000081233
Gene: ENSMUSG00000028760

Domain	Start	End	E-Value	Type
low complexity region	10	25	N/A	INTRINSIC
low complexity region	75	102	N/A	INTRINSIC
low complexity region	129	134	N/A	INTRINSIC
PDB:1LJ2\|D	136	161	8e-9	PDB
low complexity region	174	189	N/A	INTRINSIC
low complexity region	251	292	N/A	INTRINSIC
low complexity region	409	426	N/A	INTRINSIC
low complexity region	516	532	N/A	INTRINSIC
low complexity region	561	570	N/A	INTRINSIC
low complexity region	574	598	N/A	INTRINSIC
Blast:MIF4G	599	690	4e-49	BLAST
Blast:MIF4G	704	747	5e-16	BLAST
MIF4G	750	978	1.42e-65	SMART
low complexity region	1068	1113	N/A	INTRINSIC
MA3	1216	1328	9.29e-38	SMART
eIF5C	1488	1575	7.92e-36	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000105831

SMART Domains

Protein: ENSMUSP00000101457
Gene: ENSMUSG00000028760

Domain	Start	End	E-Value	Type
low complexity region	14	32	N/A	INTRINSIC
low complexity region	82	109	N/A	INTRINSIC
low complexity region	136	141	N/A	INTRINSIC
PDB:1LJ2\|D	143	168	8e-9	PDB
low complexity region	181	196	N/A	INTRINSIC
low complexity region	258	299	N/A	INTRINSIC
low complexity region	416	433	N/A	INTRINSIC
low complexity region	523	539	N/A	INTRINSIC
low complexity region	568	577	N/A	INTRINSIC
low complexity region	581	605	N/A	INTRINSIC
Blast:MIF4G	606	697	4e-49	BLAST
Blast:MIF4G	711	754	5e-16	BLAST
MIF4G	757	985	1.42e-65	SMART
low complexity region	1075	1098	N/A	INTRINSIC
MA3	1204	1316	9.29e-38	SMART
eIF5C	1476	1563	7.92e-36	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133902

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135745

Predicted Effect

probably null
Transcript: ENSMUST00000140796

SMART Domains

Protein: ENSMUSP00000115946
Gene: ENSMUSG00000028760

Domain	Start	End	E-Value	Type
low complexity region	3	12	N/A	INTRINSIC
low complexity region	16	40	N/A	INTRINSIC
Blast:MIF4G	41	132	2e-49	BLAST
Blast:MIF4G	146	189	3e-16	BLAST
MIF4G	192	420	1.42e-65	SMART
low complexity region	510	533	N/A	INTRINSIC
MA3	639	751	9.29e-38	SMART
eIF5C	911	998	7.92e-36	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000203828

SMART Domains

Protein: ENSMUSP00000145147
Gene: ENSMUSG00000028760

Domain	Start	End	E-Value	Type
low complexity region	41	81	N/A	INTRINSIC
low complexity region	193	208	N/A	INTRINSIC
low complexity region	258	285	N/A	INTRINSIC
low complexity region	312	317	N/A	INTRINSIC
PDB:1LJ2\|D	319	344	9e-9	PDB
low complexity region	357	372	N/A	INTRINSIC
low complexity region	434	475	N/A	INTRINSIC
low complexity region	592	609	N/A	INTRINSIC
low complexity region	699	715	N/A	INTRINSIC
low complexity region	744	753	N/A	INTRINSIC
low complexity region	757	781	N/A	INTRINSIC
Blast:MIF4G	782	873	9e-49	BLAST
Blast:MIF4G	887	930	5e-16	BLAST
MIF4G	933	1161	6e-68	SMART
coiled coil region	1174	1201	N/A	INTRINSIC
low complexity region	1251	1296	N/A	INTRINSIC
MA3	1399	1511	3.9e-40	SMART
eIF5C	1671	1758	3.9e-38	SMART

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.7%
20x: 93.6%

Validation Efficiency

98% (50/51)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is thought to be part of the eIF4F protein complex, which is involved in mRNA cap recognition and transport of mRNAs to the ribosome. Interestingly, a microRNA (miR-520c-3p) has been found that negatively regulates synthesis of the encoded protein, and this leads to a global decrease in protein translation and cell proliferation. Therefore, this protein is a key component of the anti-tumor activity of miR-520c-3p. [provided by RefSeq, May 2016]
PHENOTYPE: Mice homozygous for an ENU induced allele exhibit decreased testes weight, azoospermia, and arrested male meiosis. Mice homozygous for a gene trapped allele exhibit small testes. [provided by MGI curators]

Allele List at MGI

All alleles(27) : Gene trapped(27)

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700013G24Rik	G	A	4: 137,454,686	E51K	possibly damaging	Het
Abca1	A	C	4: 53,083,733	L700R	probably damaging	Het
Arpc1a	C	A	5: 145,101,222		probably null	Het
Baz2b	G	T	2: 59,924,890	P241Q	probably damaging	Het
Cd6	T	A	19: 10,794,609	T414S	probably benign	Het
Ces2b	A	T	8: 104,836,869	E409D	probably benign	Het
Cfap54	A	G	10: 92,821,119	Y3024H	probably benign	Het
Chrm1	A	G	19: 8,678,548	T206A	probably benign	Het
Clptm1l	T	C	13: 73,618,516	W512R	probably damaging	Het
Col15a1	T	A	4: 47,247,552		probably null	Het
Cox15	A	G	19: 43,736,789	S392P	probably damaging	Het
Cr2	T	C	1: 195,155,200	M1197V	probably damaging	Het
Ddx60	A	G	8: 62,000,689	K1281E	probably benign	Het
Dnah11	A	G	12: 118,045,646	F2094L	probably damaging	Het
Ear2	T	A	14: 44,102,959	C25S	probably damaging	Het
Ect2l	T	C	10: 18,140,264	D802G	probably damaging	Het
Eftud2	G	A	11: 102,838,623	Q84*	probably null	Het
Ephb2	T	C	4: 136,657,502	D866G	probably damaging	Het
Fam129b	T	A	2: 32,905,826	V22D	probably damaging	Het
Farsb	A	G	1: 78,472,497	M99T	probably damaging	Het
Foxs1	T	A	2: 152,932,720	S138C	probably damaging	Het
Frem1	T	G	4: 83,013,832	S211R	probably damaging	Het
Gm19410	G	A	8: 35,807,576	R1517Q	probably benign	Het
Gria2	T	C	3: 80,802,304	I27M	probably benign	Het
H2-Q7	A	G	17: 35,442,678	E299G	probably benign	Het
Hao2	T	G	3: 98,877,135	I305L	probably benign	Het
Hectd4	C	T	5: 121,307,381	Q122*	probably null	Het
Hivep1	T	A	13: 42,164,284	C2079S	probably damaging	Het
Hoxb1	C	A	11: 96,366,987	Q248K	probably damaging	Het
Hspb6	A	G	7: 30,554,347	D95G	probably benign	Het
Ighv5-2	T	A	12: 113,578,506	R117S	probably damaging	Het
Ino80d	A	C	1: 63,058,610	S708R	probably damaging	Het
Lman1l	A	G	9: 57,614,072		probably null	Het
Mmp15	A	G	8: 95,365,314	N51D	probably benign	Het
Naip1	T	C	13: 100,423,077	M1140V	probably benign	Het
Olfr1053	A	G	2: 86,315,065	S74P	probably damaging	Het
Olfr1373	A	G	11: 52,144,693	V279A	probably benign	Het
Olfr397	A	G	11: 73,965,465	N286D	probably damaging	Het
Olfr890	T	A	9: 38,143,153	M1K	probably null	Het
Pard3b	A	T	1: 62,159,470	N239I	probably damaging	Het
Parvb	C	T	15: 84,297,979	R237W	probably damaging	Het
Pcdha9	T	C	18: 36,998,069	S64P	probably damaging	Het
Pdcd1	T	C	1: 94,041,389	N68S	probably benign	Het
Pi4ka	G	T	16: 17,326,052		probably null	Het
Plekha4	A	T	7: 45,540,886	D359V	possibly damaging	Het
Serpinb13	A	G	1: 106,994,062	I78V	probably benign	Het
Slc39a7	T	A	17: 34,030,108	T269S	probably benign	Het
Sltm	T	G	9: 70,573,710	D281E	probably damaging	Het
Zfp708	T	C	13: 67,071,432	Y76C	probably damaging	Het
Zfp990	T	A	4: 145,536,927	V165D	possibly damaging	Het

Other mutations in Eif4g3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01817:Eif4g3	APN	4	138120362	missense	probably benign	0.01
IGL02171:Eif4g3	APN	4	138126589	missense	probably benign	0.03
IGL02487:Eif4g3	APN	4	138203378	missense	possibly damaging	0.92
IGL02514:Eif4g3	APN	4	138126194	missense	possibly damaging	0.87
IGL02622:Eif4g3	APN	4	138097366	splice site	probably benign
IGL02725:Eif4g3	APN	4	138170471	splice site	probably benign
IGL02735:Eif4g3	APN	4	138126211	missense	probably benign	0.40
IGL03008:Eif4g3	APN	4	138120388	missense	probably damaging	1.00
IGL03077:Eif4g3	APN	4	138125855	missense	probably damaging	1.00
N/A - 535:Eif4g3	UTSW	4	138120428	missense	probably damaging	0.98
R0013:Eif4g3	UTSW	4	138175848	missense	possibly damaging	0.88
R0193:Eif4g3	UTSW	4	138146376	splice site	probably benign
R0240:Eif4g3	UTSW	4	138170562	missense	probably damaging	0.98
R0240:Eif4g3	UTSW	4	138170562	missense	probably damaging	0.98
R0563:Eif4g3	UTSW	4	138175840	splice site	probably benign
R0841:Eif4g3	UTSW	4	138165818	missense	probably damaging	1.00
R0884:Eif4g3	UTSW	4	138151776	missense	possibly damaging	0.76
R1116:Eif4g3	UTSW	4	138091775	critical splice donor site	probably null
R1145:Eif4g3	UTSW	4	138165818	missense	probably damaging	1.00
R1145:Eif4g3	UTSW	4	138165818	missense	probably damaging	1.00
R1192:Eif4g3	UTSW	4	138171186	missense	probably damaging	1.00
R1401:Eif4g3	UTSW	4	138206084	missense	probably damaging	0.99
R1535:Eif4g3	UTSW	4	138097302	missense	probably damaging	1.00
R1571:Eif4g3	UTSW	4	138120408	missense	probably damaging	1.00
R1576:Eif4g3	UTSW	4	138096870	missense	probably damaging	0.99
R1607:Eif4g3	UTSW	4	138126563	missense	probably benign	0.00
R1618:Eif4g3	UTSW	4	138206058	missense	probably damaging	1.00
R1793:Eif4g3	UTSW	4	138171131	missense	probably damaging	1.00
R1823:Eif4g3	UTSW	4	138180491	missense	probably benign	0.37
R1857:Eif4g3	UTSW	4	138175876	missense	possibly damaging	0.67
R1907:Eif4g3	UTSW	4	138158415	missense	probably damaging	1.00
R2041:Eif4g3	UTSW	4	138105306	splice site	probably benign
R2106:Eif4g3	UTSW	4	138082919	start gained	probably benign
R2124:Eif4g3	UTSW	4	138184742	missense	probably damaging	1.00
R2301:Eif4g3	UTSW	4	138172659	missense	probably damaging	1.00
R2519:Eif4g3	UTSW	4	138097318	missense	probably benign	0.37
R3033:Eif4g3	UTSW	4	138103410	missense	probably damaging	1.00
R3870:Eif4g3	UTSW	4	138096900	missense	probably damaging	0.98
R4542:Eif4g3	UTSW	4	138203417	missense	probably damaging	0.99
R4582:Eif4g3	UTSW	4	138171245	missense	probably damaging	1.00
R4607:Eif4g3	UTSW	4	138126458	missense	probably benign	0.03
R4608:Eif4g3	UTSW	4	138126458	missense	probably benign	0.03
R4658:Eif4g3	UTSW	4	138206132	missense	probably damaging	1.00
R4736:Eif4g3	UTSW	4	138198097	missense	probably benign	0.01
R4739:Eif4g3	UTSW	4	138183199	missense	possibly damaging	0.79
R4739:Eif4g3	UTSW	4	138198097	missense	probably benign	0.01
R4740:Eif4g3	UTSW	4	138198097	missense	probably benign	0.01
R4760:Eif4g3	UTSW	4	138084318	missense	possibly damaging	0.46
R4825:Eif4g3	UTSW	4	138194081	missense	probably benign
R4826:Eif4g3	UTSW	4	138177945	missense	possibly damaging	0.95
R4941:Eif4g3	UTSW	4	138170565	missense	probably damaging	1.00
R5040:Eif4g3	UTSW	4	138096889	missense	probably damaging	0.99
R5070:Eif4g3	UTSW	4	138146299	missense	probably benign	0.00
R5155:Eif4g3	UTSW	4	138126743	missense	probably benign	0.36
R5226:Eif4g3	UTSW	4	138096794	missense	possibly damaging	0.93
R5229:Eif4g3	UTSW	4	138096794	missense	possibly damaging	0.93
R5303:Eif4g3	UTSW	4	138126562	missense	probably benign	0.04
R5369:Eif4g3	UTSW	4	138183334	missense	possibly damaging	0.87
R5394:Eif4g3	UTSW	4	138103398	splice site	probably null
R5665:Eif4g3	UTSW	4	138126589	missense	probably benign	0.03
R5678:Eif4g3	UTSW	4	138151742	missense	probably damaging	0.99
R5695:Eif4g3	UTSW	4	138163433	splice site	probably null
R5704:Eif4g3	UTSW	4	138190692	missense	probably damaging	1.00
R5924:Eif4g3	UTSW	4	138201926	missense	probably damaging	1.00
R6214:Eif4g3	UTSW	4	138058003	missense	probably damaging	0.99
R6278:Eif4g3	UTSW	4	138188083	missense	possibly damaging	0.82
R6519:Eif4g3	UTSW	4	137994008	missense	probably benign
R6659:Eif4g3	UTSW	4	138177932	missense	probably damaging	1.00
R6812:Eif4g3	UTSW	4	138103376	missense	probably damaging	1.00
R6922:Eif4g3	UTSW	4	138097335	missense	probably damaging	1.00
R7175:Eif4g3	UTSW	4	138126215	missense	probably damaging	1.00
R7176:Eif4g3	UTSW	4	138171186	missense	probably damaging	1.00
R7598:Eif4g3	UTSW	4	138194124	missense	probably benign	0.02
R7618:Eif4g3	UTSW	4	138171118	missense	probably damaging	1.00
R7805:Eif4g3	UTSW	4	138146354	missense	probably benign	0.00
R7935:Eif4g3	UTSW	4	138096771	missense	probably damaging	1.00
R7983:Eif4g3	UTSW	4	138151593	missense	probably benign	0.00
R8261:Eif4g3	UTSW	4	138171118	missense	possibly damaging	0.46
R8371:Eif4g3	UTSW	4	138096845	missense	probably damaging	1.00
R8499:Eif4g3	UTSW	4	138165928	missense	probably damaging	1.00
R8670:Eif4g3	UTSW	4	138158512	critical splice donor site	probably null
R8672:Eif4g3	UTSW	4	138126512	missense	possibly damaging	0.75
R8744:Eif4g3	UTSW	4	137994061	small deletion	probably benign
R8767:Eif4g3	UTSW	4	138203468	missense	probably damaging	0.99
R8771:Eif4g3	UTSW	4	138180537	nonsense	probably null
R8989:Eif4g3	UTSW	4	138184748	missense	probably damaging	1.00
R9292:Eif4g3	UTSW	4	138194071	missense	possibly damaging	0.82
R9294:Eif4g3	UTSW	4	138190657	missense	probably damaging	0.98
R9607:Eif4g3	UTSW	4	138165734	missense	probably benign	0.28
R9617:Eif4g3	UTSW	4	138096879	missense	probably damaging	0.99
RF008:Eif4g3	UTSW	4	138175924	missense	probably damaging	0.98
X0067:Eif4g3	UTSW	4	138163619	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- GTTTATGCAGTGGAAAAGTAGACGC -3'
(R):5'- GACACACTGTAGGATGGAGC -3'

Sequencing Primer
(F):5'- CCTCCTGTGTACTGGGACTAAAG -3'
(R):5'- AGCACTTGCCTAGCAGTCC -3'

Posted On

2018-08-01