Mutagenetix > Incidental Mutations

Incidental Mutation 'R6720:Arpc1a'

529536

Institutional Source

Beutler Lab

Gene Symbol

Arpc1a

Ensembl Gene

ENSMUSG00000029621

Gene Name

actin related protein 2/3 complex, subunit 1A

Synonyms

Sid32, 0610010H08Rik, 1110030K07Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.867) question?

Stock #

R6720 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

145083830-145108761 bp(+) (GRCm38)

Type of Mutation

splice site (3994 bp from exon)

DNA Base Change (assembly)

C to A at 145101222 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000114421 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031625] [ENSMUST00000124379] [ENSMUST00000127694]

AlphaFold

Q9R0Q6

Predicted Effect

probably null
Transcript: ENSMUST00000031625

SMART Domains

Protein: ENSMUSP00000031625
Gene: ENSMUSG00000029621

Domain	Start	End	E-Value	Type
Blast:WD40	1	36	1e-18	BLAST
WD40	41	80	2.55e-6	SMART
WD40	89	124	1.1e2	SMART
WD40	134	170	1.46e-1	SMART
WD40	191	232	4.62e-1	SMART
WD40	235	273	9.51e1	SMART
WD40	312	356	3.68e1	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000124379

SMART Domains

Protein: ENSMUSP00000114421
Gene: ENSMUSG00000029621

Domain	Start	End	E-Value	Type
Blast:WD40	1	36	2e-19	BLAST
WD40	41	80	2.55e-6	SMART
WD40	89	124	1.1e2	SMART

Predicted Effect

silent
Transcript: ENSMUST00000127694

SMART Domains

Protein: ENSMUSP00000143026
Gene: ENSMUSG00000029621

Domain	Start	End	E-Value	Type
Blast:WD40	1	36	2e-18	BLAST
WD40	41	80	1.6e-8	SMART
WD40	89	124	6.8e-1	SMART
WD40	134	170	8.9e-4	SMART
WD40	191	232	2.8e-3	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142276

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147564

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.7%
20x: 93.6%

Validation Efficiency

98% (50/51)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of seven subunits of the human Arp2/3 protein complex. This subunit is a member of the SOP2 family of proteins and is most similar to the protein encoded by gene ARPC1B. The similarity between these two proteins suggests that they both may function as p41 subunit of the human Arp2/3 complex that has been implicated in the control of actin polymerization in cells. It is possible that the p41 subunit is involved in assembling and maintaining the structure of the Arp2/3 complex. Multiple versions of the p41 subunit may adapt the functions of the complex to different cell types or developmental stages. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2010]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700013G24Rik	G	A	4: 137,454,686	E51K	possibly damaging	Het
Abca1	A	C	4: 53,083,733	L700R	probably damaging	Het
Baz2b	G	T	2: 59,924,890	P241Q	probably damaging	Het
Cd6	T	A	19: 10,794,609	T414S	probably benign	Het
Ces2b	A	T	8: 104,836,869	E409D	probably benign	Het
Cfap54	A	G	10: 92,821,119	Y3024H	probably benign	Het
Chrm1	A	G	19: 8,678,548	T206A	probably benign	Het
Clptm1l	T	C	13: 73,618,516	W512R	probably damaging	Het
Col15a1	T	A	4: 47,247,552		probably null	Het
Cox15	A	G	19: 43,736,789	S392P	probably damaging	Het
Cr2	T	C	1: 195,155,200	M1197V	probably damaging	Het
Ddx60	A	G	8: 62,000,689	K1281E	probably benign	Het
Dnah11	A	G	12: 118,045,646	F2094L	probably damaging	Het
Ear2	T	A	14: 44,102,959	C25S	probably damaging	Het
Ect2l	T	C	10: 18,140,264	D802G	probably damaging	Het
Eftud2	G	A	11: 102,838,623	Q84*	probably null	Het
Eif4g3	T	A	4: 138,175,832		probably null	Het
Ephb2	T	C	4: 136,657,502	D866G	probably damaging	Het
Fam129b	T	A	2: 32,905,826	V22D	probably damaging	Het
Farsb	A	G	1: 78,472,497	M99T	probably damaging	Het
Foxs1	T	A	2: 152,932,720	S138C	probably damaging	Het
Frem1	T	G	4: 83,013,832	S211R	probably damaging	Het
Gm19410	G	A	8: 35,807,576	R1517Q	probably benign	Het
Gria2	T	C	3: 80,802,304	I27M	probably benign	Het
H2-Q7	A	G	17: 35,442,678	E299G	probably benign	Het
Hao2	T	G	3: 98,877,135	I305L	probably benign	Het
Hectd4	C	T	5: 121,307,381	Q122*	probably null	Het
Hivep1	T	A	13: 42,164,284	C2079S	probably damaging	Het
Hoxb1	C	A	11: 96,366,987	Q248K	probably damaging	Het
Hspb6	A	G	7: 30,554,347	D95G	probably benign	Het
Ighv5-2	T	A	12: 113,578,506	R117S	probably damaging	Het
Ino80d	A	C	1: 63,058,610	S708R	probably damaging	Het
Lman1l	A	G	9: 57,614,072		probably null	Het
Mmp15	A	G	8: 95,365,314	N51D	probably benign	Het
Naip1	T	C	13: 100,423,077	M1140V	probably benign	Het
Olfr1053	A	G	2: 86,315,065	S74P	probably damaging	Het
Olfr1373	A	G	11: 52,144,693	V279A	probably benign	Het
Olfr397	A	G	11: 73,965,465	N286D	probably damaging	Het
Olfr890	T	A	9: 38,143,153	M1K	probably null	Het
Pard3b	A	T	1: 62,159,470	N239I	probably damaging	Het
Parvb	C	T	15: 84,297,979	R237W	probably damaging	Het
Pcdha9	T	C	18: 36,998,069	S64P	probably damaging	Het
Pdcd1	T	C	1: 94,041,389	N68S	probably benign	Het
Pi4ka	G	T	16: 17,326,052		probably null	Het
Plekha4	A	T	7: 45,540,886	D359V	possibly damaging	Het
Serpinb13	A	G	1: 106,994,062	I78V	probably benign	Het
Slc39a7	T	A	17: 34,030,108	T269S	probably benign	Het
Sltm	T	G	9: 70,573,710	D281E	probably damaging	Het
Zfp708	T	C	13: 67,071,432	Y76C	probably damaging	Het
Zfp990	T	A	4: 145,536,927	V165D	possibly damaging	Het

Other mutations in Arpc1a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01503:Arpc1a	APN	5	145096154	missense	probably damaging	1.00
IGL02672:Arpc1a	APN	5	145104887	missense	probably damaging	0.99
R0068:Arpc1a	UTSW	5	145091244	missense	possibly damaging	0.62
R0068:Arpc1a	UTSW	5	145091244	missense	possibly damaging	0.62
R1347:Arpc1a	UTSW	5	145097272	missense	probably damaging	1.00
R1347:Arpc1a	UTSW	5	145097272	missense	probably damaging	1.00
R1446:Arpc1a	UTSW	5	145101086	splice site	probably null
R1870:Arpc1a	UTSW	5	145107091	missense	possibly damaging	0.80
R1871:Arpc1a	UTSW	5	145107091	missense	possibly damaging	0.80
R2154:Arpc1a	UTSW	5	145092559	missense	probably benign	0.33
R2385:Arpc1a	UTSW	5	145104523	splice site	probably null
R3698:Arpc1a	UTSW	5	145096191	missense	probably damaging	0.98
R6462:Arpc1a	UTSW	5	145108387	missense	probably benign	0.01
R6825:Arpc1a	UTSW	5	145096126	nonsense	probably null
R7174:Arpc1a	UTSW	5	145097277	missense	probably benign	0.38
R7473:Arpc1a	UTSW	5	145101076	missense	probably benign
R7619:Arpc1a	UTSW	5	145104858	missense	probably benign	0.36
R7775:Arpc1a	UTSW	5	145104812	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TGTTTCGAACAACAGAGTGTTC -3'
(R):5'- GTGTTTCTGGAAGGAAGTCCC -3'

Sequencing Primer
(F):5'- CTCTGCCTATATCAAAGAGGTGG -3'
(R):5'- GTTTCTGGAAGGAAGTCCCAACTC -3'

Posted On

2018-08-01