Incidental Mutation 'R6720:Arpc1a'
ID 529536
Institutional Source Beutler Lab
Gene Symbol Arpc1a
Ensembl Gene ENSMUSG00000029621
Gene Name actin related protein 2/3 complex, subunit 1A
Synonyms Sid32, 0610010H08Rik, 1110030K07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.913) question?
Stock # R6720 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 145083830-145108761 bp(+) (GRCm38)
Type of Mutation splice site (3994 bp from exon)
DNA Base Change (assembly) C to A at 145101222 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000114421 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031625] [ENSMUST00000124379] [ENSMUST00000127694]
AlphaFold Q9R0Q6
Predicted Effect probably null
Transcript: ENSMUST00000031625
SMART Domains Protein: ENSMUSP00000031625
Gene: ENSMUSG00000029621

DomainStartEndE-ValueType
Blast:WD40 1 36 1e-18 BLAST
WD40 41 80 2.55e-6 SMART
WD40 89 124 1.1e2 SMART
WD40 134 170 1.46e-1 SMART
WD40 191 232 4.62e-1 SMART
WD40 235 273 9.51e1 SMART
WD40 312 356 3.68e1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000124379
SMART Domains Protein: ENSMUSP00000114421
Gene: ENSMUSG00000029621

DomainStartEndE-ValueType
Blast:WD40 1 36 2e-19 BLAST
WD40 41 80 2.55e-6 SMART
WD40 89 124 1.1e2 SMART
Predicted Effect silent
Transcript: ENSMUST00000127694
SMART Domains Protein: ENSMUSP00000143026
Gene: ENSMUSG00000029621

DomainStartEndE-ValueType
Blast:WD40 1 36 2e-18 BLAST
WD40 41 80 1.6e-8 SMART
WD40 89 124 6.8e-1 SMART
WD40 134 170 8.9e-4 SMART
WD40 191 232 2.8e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142276
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147564
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.6%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of seven subunits of the human Arp2/3 protein complex. This subunit is a member of the SOP2 family of proteins and is most similar to the protein encoded by gene ARPC1B. The similarity between these two proteins suggests that they both may function as p41 subunit of the human Arp2/3 complex that has been implicated in the control of actin polymerization in cells. It is possible that the p41 subunit is involved in assembling and maintaining the structure of the Arp2/3 complex. Multiple versions of the p41 subunit may adapt the functions of the complex to different cell types or developmental stages. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2010]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik G A 4: 137,454,686 E51K possibly damaging Het
Abca1 A C 4: 53,083,733 L700R probably damaging Het
Baz2b G T 2: 59,924,890 P241Q probably damaging Het
Cd6 T A 19: 10,794,609 T414S probably benign Het
Ces2b A T 8: 104,836,869 E409D probably benign Het
Cfap54 A G 10: 92,821,119 Y3024H probably benign Het
Chrm1 A G 19: 8,678,548 T206A probably benign Het
Clptm1l T C 13: 73,618,516 W512R probably damaging Het
Col15a1 T A 4: 47,247,552 probably null Het
Cox15 A G 19: 43,736,789 S392P probably damaging Het
Cr2 T C 1: 195,155,200 M1197V probably damaging Het
Ddx60 A G 8: 62,000,689 K1281E probably benign Het
Dnah11 A G 12: 118,045,646 F2094L probably damaging Het
Ear2 T A 14: 44,102,959 C25S probably damaging Het
Ect2l T C 10: 18,140,264 D802G probably damaging Het
Eftud2 G A 11: 102,838,623 Q84* probably null Het
Eif4g3 T A 4: 138,175,832 probably null Het
Ephb2 T C 4: 136,657,502 D866G probably damaging Het
Fam129b T A 2: 32,905,826 V22D probably damaging Het
Farsb A G 1: 78,472,497 M99T probably damaging Het
Foxs1 T A 2: 152,932,720 S138C probably damaging Het
Frem1 T G 4: 83,013,832 S211R probably damaging Het
Gm19410 G A 8: 35,807,576 R1517Q probably benign Het
Gria2 T C 3: 80,802,304 I27M probably benign Het
H2-Q7 A G 17: 35,442,678 E299G probably benign Het
Hao2 T G 3: 98,877,135 I305L probably benign Het
Hectd4 C T 5: 121,307,381 Q122* probably null Het
Hivep1 T A 13: 42,164,284 C2079S probably damaging Het
Hoxb1 C A 11: 96,366,987 Q248K probably damaging Het
Hspb6 A G 7: 30,554,347 D95G probably benign Het
Ighv5-2 T A 12: 113,578,506 R117S probably damaging Het
Ino80d A C 1: 63,058,610 S708R probably damaging Het
Lman1l A G 9: 57,614,072 probably null Het
Mmp15 A G 8: 95,365,314 N51D probably benign Het
Naip1 T C 13: 100,423,077 M1140V probably benign Het
Olfr1053 A G 2: 86,315,065 S74P probably damaging Het
Olfr1373 A G 11: 52,144,693 V279A probably benign Het
Olfr397 A G 11: 73,965,465 N286D probably damaging Het
Olfr890 T A 9: 38,143,153 M1K probably null Het
Pard3b A T 1: 62,159,470 N239I probably damaging Het
Parvb C T 15: 84,297,979 R237W probably damaging Het
Pcdha9 T C 18: 36,998,069 S64P probably damaging Het
Pdcd1 T C 1: 94,041,389 N68S probably benign Het
Pi4ka G T 16: 17,326,052 probably null Het
Plekha4 A T 7: 45,540,886 D359V possibly damaging Het
Serpinb13 A G 1: 106,994,062 I78V probably benign Het
Slc39a7 T A 17: 34,030,108 T269S probably benign Het
Sltm T G 9: 70,573,710 D281E probably damaging Het
Zfp708 T C 13: 67,071,432 Y76C probably damaging Het
Zfp990 T A 4: 145,536,927 V165D possibly damaging Het
Other mutations in Arpc1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01503:Arpc1a APN 5 145096154 missense probably damaging 1.00
IGL02672:Arpc1a APN 5 145104887 missense probably damaging 0.99
R0068:Arpc1a UTSW 5 145091244 missense possibly damaging 0.62
R0068:Arpc1a UTSW 5 145091244 missense possibly damaging 0.62
R1347:Arpc1a UTSW 5 145097272 missense probably damaging 1.00
R1347:Arpc1a UTSW 5 145097272 missense probably damaging 1.00
R1446:Arpc1a UTSW 5 145101086 splice site probably null
R1870:Arpc1a UTSW 5 145107091 missense possibly damaging 0.80
R1871:Arpc1a UTSW 5 145107091 missense possibly damaging 0.80
R2154:Arpc1a UTSW 5 145092559 missense probably benign 0.33
R2385:Arpc1a UTSW 5 145104523 splice site probably null
R3698:Arpc1a UTSW 5 145096191 missense probably damaging 0.98
R6462:Arpc1a UTSW 5 145108387 missense probably benign 0.01
R6825:Arpc1a UTSW 5 145096126 nonsense probably null
R7174:Arpc1a UTSW 5 145097277 missense probably benign 0.38
R7473:Arpc1a UTSW 5 145101076 missense probably benign
R7619:Arpc1a UTSW 5 145104858 missense probably benign 0.36
R7775:Arpc1a UTSW 5 145104812 missense probably benign 0.00
R9433:Arpc1a UTSW 5 145108393 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- TGTTTCGAACAACAGAGTGTTC -3'
(R):5'- GTGTTTCTGGAAGGAAGTCCC -3'

Sequencing Primer
(F):5'- CTCTGCCTATATCAAAGAGGTGG -3'
(R):5'- GTTTCTGGAAGGAAGTCCCAACTC -3'
Posted On 2018-08-01