Incidental Mutation 'R6720:Plekha4'
ID 529538
Institutional Source Beutler Lab
Gene Symbol Plekha4
Ensembl Gene ENSMUSG00000040428
Gene Name pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 4
Synonyms 2410005C22Rik, PEPP1
MMRRC Submission 044838-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.118) question?
Stock # R6720 (G1)
Quality Score 185.009
Status Validated
Chromosome 7
Chromosomal Location 45175754-45203653 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 45190310 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 359 (D359V)
Ref Sequence ENSEMBL: ENSMUSP00000147878 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051810] [ENSMUST00000209517] [ENSMUST00000211155] [ENSMUST00000211227] [ENSMUST00000211797]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000051810
AA Change: D387V

PolyPhen 2 Score 0.770 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000051468
Gene: ENSMUSG00000040428
AA Change: D387V

DomainStartEndE-ValueType
low complexity region 8 27 N/A INTRINSIC
PH 55 155 8.18e-19 SMART
low complexity region 162 190 N/A INTRINSIC
low complexity region 228 260 N/A INTRINSIC
low complexity region 292 303 N/A INTRINSIC
low complexity region 321 334 N/A INTRINSIC
coiled coil region 376 419 N/A INTRINSIC
low complexity region 519 535 N/A INTRINSIC
low complexity region 608 628 N/A INTRINSIC
low complexity region 649 659 N/A INTRINSIC
low complexity region 706 719 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000209517
AA Change: D387V

PolyPhen 2 Score 0.770 (Sensitivity: 0.85; Specificity: 0.92)
Predicted Effect possibly damaging
Transcript: ENSMUST00000211155
AA Change: D359V

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000211227
AA Change: D387V

PolyPhen 2 Score 0.480 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211794
Predicted Effect possibly damaging
Transcript: ENSMUST00000211797
AA Change: D316V

PolyPhen 2 Score 0.748 (Sensitivity: 0.85; Specificity: 0.92)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.6%
Validation Efficiency 98% (50/51)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik G A 4: 137,181,997 (GRCm39) E51K possibly damaging Het
Abca1 A C 4: 53,083,733 (GRCm39) L700R probably damaging Het
Arpc1a C A 5: 145,038,032 (GRCm39) probably null Het
Baz2b G T 2: 59,755,234 (GRCm39) P241Q probably damaging Het
Cd6 T A 19: 10,771,973 (GRCm39) T414S probably benign Het
Ces2b A T 8: 105,563,501 (GRCm39) E409D probably benign Het
Cfap54 A G 10: 92,656,981 (GRCm39) Y3024H probably benign Het
Chrm1 A G 19: 8,655,912 (GRCm39) T206A probably benign Het
Clptm1l T C 13: 73,766,635 (GRCm39) W512R probably damaging Het
Col15a1 T A 4: 47,247,552 (GRCm39) probably null Het
Cox15 A G 19: 43,725,228 (GRCm39) S392P probably damaging Het
Cplx3 A G 9: 57,521,355 (GRCm39) probably null Het
Cr2 T C 1: 194,837,508 (GRCm39) M1197V probably damaging Het
Ddx60 A G 8: 62,453,723 (GRCm39) K1281E probably benign Het
Dnah11 A G 12: 118,009,381 (GRCm39) F2094L probably damaging Het
Ear2 T A 14: 44,340,416 (GRCm39) C25S probably damaging Het
Ect2l T C 10: 18,016,012 (GRCm39) D802G probably damaging Het
Eftud2 G A 11: 102,729,449 (GRCm39) Q84* probably null Het
Eif4g3 T A 4: 137,903,143 (GRCm39) probably null Het
Ephb2 T C 4: 136,384,813 (GRCm39) D866G probably damaging Het
Farsb A G 1: 78,449,134 (GRCm39) M99T probably damaging Het
Foxs1 T A 2: 152,774,640 (GRCm39) S138C probably damaging Het
Frem1 T G 4: 82,932,069 (GRCm39) S211R probably damaging Het
Gm19410 G A 8: 36,274,730 (GRCm39) R1517Q probably benign Het
Gria2 T C 3: 80,709,611 (GRCm39) I27M probably benign Het
H2-Q7 A G 17: 35,661,654 (GRCm39) E299G probably benign Het
Hao2 T G 3: 98,784,451 (GRCm39) I305L probably benign Het
Hectd4 C T 5: 121,445,444 (GRCm39) Q122* probably null Het
Hivep1 T A 13: 42,317,760 (GRCm39) C2079S probably damaging Het
Hoxb1 C A 11: 96,257,813 (GRCm39) Q248K probably damaging Het
Hspb6 A G 7: 30,253,772 (GRCm39) D95G probably benign Het
Ighv5-2 T A 12: 113,542,126 (GRCm39) R117S probably damaging Het
Ino80d A C 1: 63,097,769 (GRCm39) S708R probably damaging Het
Mmp15 A G 8: 96,091,942 (GRCm39) N51D probably benign Het
Naip1 T C 13: 100,559,585 (GRCm39) M1140V probably benign Het
Niban2 T A 2: 32,795,838 (GRCm39) V22D probably damaging Het
Or1e1f A G 11: 73,856,291 (GRCm39) N286D probably damaging Het
Or2y8 A G 11: 52,035,520 (GRCm39) V279A probably benign Het
Or8b41 T A 9: 38,054,449 (GRCm39) M1K probably null Het
Or8k21 A G 2: 86,145,409 (GRCm39) S74P probably damaging Het
Pard3b A T 1: 62,198,629 (GRCm39) N239I probably damaging Het
Parvb C T 15: 84,182,180 (GRCm39) R237W probably damaging Het
Pcdha9 T C 18: 37,131,122 (GRCm39) S64P probably damaging Het
Pdcd1 T C 1: 93,969,114 (GRCm39) N68S probably benign Het
Pi4ka G T 16: 17,143,916 (GRCm39) probably null Het
Serpinb13 A G 1: 106,921,792 (GRCm39) I78V probably benign Het
Slc39a7 T A 17: 34,249,082 (GRCm39) T269S probably benign Het
Sltm T G 9: 70,480,992 (GRCm39) D281E probably damaging Het
Zfp708 T C 13: 67,219,496 (GRCm39) Y76C probably damaging Het
Zfp990 T A 4: 145,263,497 (GRCm39) V165D possibly damaging Het
Other mutations in Plekha4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01308:Plekha4 APN 7 45,187,659 (GRCm39) missense probably damaging 0.97
IGL01716:Plekha4 APN 7 45,183,767 (GRCm39) missense probably damaging 0.98
IGL02072:Plekha4 APN 7 45,187,722 (GRCm39) missense probably benign 0.29
IGL02815:Plekha4 APN 7 45,187,836 (GRCm39) missense probably damaging 1.00
IGL02939:Plekha4 APN 7 45,181,787 (GRCm39) nonsense probably null
PIT4494001:Plekha4 UTSW 7 45,197,503 (GRCm39) missense probably damaging 1.00
R0085:Plekha4 UTSW 7 45,193,373 (GRCm39) nonsense probably null
R0239:Plekha4 UTSW 7 45,181,782 (GRCm39) missense probably damaging 1.00
R0239:Plekha4 UTSW 7 45,181,782 (GRCm39) missense probably damaging 1.00
R1036:Plekha4 UTSW 7 45,199,400 (GRCm39) splice site probably benign
R1955:Plekha4 UTSW 7 45,203,330 (GRCm39) missense probably damaging 0.99
R2049:Plekha4 UTSW 7 45,203,222 (GRCm39) missense probably benign 0.01
R2187:Plekha4 UTSW 7 45,198,698 (GRCm39) missense probably damaging 0.99
R2888:Plekha4 UTSW 7 45,187,668 (GRCm39) missense probably damaging 1.00
R5086:Plekha4 UTSW 7 45,203,082 (GRCm39) missense possibly damaging 0.82
R5357:Plekha4 UTSW 7 45,184,195 (GRCm39) missense probably damaging 1.00
R5604:Plekha4 UTSW 7 45,198,580 (GRCm39) missense probably damaging 0.96
R5611:Plekha4 UTSW 7 45,203,065 (GRCm39) missense probably benign
R6255:Plekha4 UTSW 7 45,203,226 (GRCm39) utr 3 prime probably benign
R6341:Plekha4 UTSW 7 45,190,572 (GRCm39) missense probably damaging 1.00
R6502:Plekha4 UTSW 7 45,180,000 (GRCm39) start codon destroyed probably null 0.87
R6776:Plekha4 UTSW 7 45,184,241 (GRCm39) missense probably damaging 1.00
R8057:Plekha4 UTSW 7 45,198,695 (GRCm39) missense probably benign
R9095:Plekha4 UTSW 7 45,190,492 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTCGAGCCCTTTGAAGTG -3'
(R):5'- TGCACAGACCACAGCGATTG -3'

Sequencing Primer
(F):5'- CTTTATAGTTGGGAGTCACCACAAGG -3'
(R):5'- CCACAGCGATTGGACTTCTGAAG -3'
Posted On 2018-08-01