Mutagenetix > Incidental Mutation

Incidental Mutation 'R6720:Gm19410'

529539

Institutional Source

Beutler Lab

Gene Symbol

Gm19410

Ensembl Gene

ENSMUSG00000109372

Gene Name

predicted gene, 19410

Synonyms

MMRRC Submission

044838-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.092) question?

Stock #

R6720 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

35765790-35818047 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 35807576 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glutamine at position 1517 (R1517Q)

Ref Sequence

ENSEMBL: ENSMUSP00000147162 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000207505]

AlphaFold

A0A140LJC7

Predicted Effect

probably benign
Transcript: ENSMUST00000207505
AA Change: R1517Q

PolyPhen 2 Score 0.117 (Sensitivity: 0.93; Specificity: 0.86)

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.7%
20x: 93.6%

Validation Efficiency

98% (50/51)

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700013G24Rik	G	A	4: 137,454,686	E51K	possibly damaging	Het
Abca1	A	C	4: 53,083,733	L700R	probably damaging	Het
Arpc1a	C	A	5: 145,101,222		probably null	Het
Baz2b	G	T	2: 59,924,890	P241Q	probably damaging	Het
Cd6	T	A	19: 10,794,609	T414S	probably benign	Het
Ces2b	A	T	8: 104,836,869	E409D	probably benign	Het
Cfap54	A	G	10: 92,821,119	Y3024H	probably benign	Het
Chrm1	A	G	19: 8,678,548	T206A	probably benign	Het
Clptm1l	T	C	13: 73,618,516	W512R	probably damaging	Het
Col15a1	T	A	4: 47,247,552		probably null	Het
Cox15	A	G	19: 43,736,789	S392P	probably damaging	Het
Cr2	T	C	1: 195,155,200	M1197V	probably damaging	Het
Ddx60	A	G	8: 62,000,689	K1281E	probably benign	Het
Dnah11	A	G	12: 118,045,646	F2094L	probably damaging	Het
Ear2	T	A	14: 44,102,959	C25S	probably damaging	Het
Ect2l	T	C	10: 18,140,264	D802G	probably damaging	Het
Eftud2	G	A	11: 102,838,623	Q84*	probably null	Het
Eif4g3	T	A	4: 138,175,832		probably null	Het
Ephb2	T	C	4: 136,657,502	D866G	probably damaging	Het
Fam129b	T	A	2: 32,905,826	V22D	probably damaging	Het
Farsb	A	G	1: 78,472,497	M99T	probably damaging	Het
Foxs1	T	A	2: 152,932,720	S138C	probably damaging	Het
Frem1	T	G	4: 83,013,832	S211R	probably damaging	Het
Gria2	T	C	3: 80,802,304	I27M	probably benign	Het
H2-Q7	A	G	17: 35,442,678	E299G	probably benign	Het
Hao2	T	G	3: 98,877,135	I305L	probably benign	Het
Hectd4	C	T	5: 121,307,381	Q122*	probably null	Het
Hivep1	T	A	13: 42,164,284	C2079S	probably damaging	Het
Hoxb1	C	A	11: 96,366,987	Q248K	probably damaging	Het
Hspb6	A	G	7: 30,554,347	D95G	probably benign	Het
Ighv5-2	T	A	12: 113,578,506	R117S	probably damaging	Het
Ino80d	A	C	1: 63,058,610	S708R	probably damaging	Het
Lman1l	A	G	9: 57,614,072		probably null	Het
Mmp15	A	G	8: 95,365,314	N51D	probably benign	Het
Naip1	T	C	13: 100,423,077	M1140V	probably benign	Het
Olfr1053	A	G	2: 86,315,065	S74P	probably damaging	Het
Olfr1373	A	G	11: 52,144,693	V279A	probably benign	Het
Olfr397	A	G	11: 73,965,465	N286D	probably damaging	Het
Olfr890	T	A	9: 38,143,153	M1K	probably null	Het
Pard3b	A	T	1: 62,159,470	N239I	probably damaging	Het
Parvb	C	T	15: 84,297,979	R237W	probably damaging	Het
Pcdha9	T	C	18: 36,998,069	S64P	probably damaging	Het
Pdcd1	T	C	1: 94,041,389	N68S	probably benign	Het
Pi4ka	G	T	16: 17,326,052		probably null	Het
Plekha4	A	T	7: 45,540,886	D359V	possibly damaging	Het
Serpinb13	A	G	1: 106,994,062	I78V	probably benign	Het
Slc39a7	T	A	17: 34,030,108	T269S	probably benign	Het
Sltm	T	G	9: 70,573,710	D281E	probably damaging	Het
Zfp708	T	C	13: 67,071,432	Y76C	probably damaging	Het
Zfp990	T	A	4: 145,536,927	V165D	possibly damaging	Het

Other mutations in Gm19410

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
BB009:Gm19410	UTSW	8	35795599	missense	probably damaging	0.98
BB019:Gm19410	UTSW	8	35795599	missense	probably damaging	0.98
R0046:Gm19410	UTSW	8	35802645	missense	probably benign	0.31
R6026:Gm19410	UTSW	8	35812426	missense	probably benign	0.03
R6039:Gm19410	UTSW	8	35809364	missense	probably benign	0.44
R6039:Gm19410	UTSW	8	35809364	missense	probably benign	0.44
R6185:Gm19410	UTSW	8	35807510	missense	possibly damaging	0.87
R6239:Gm19410	UTSW	8	35778764	missense	probably damaging	0.98
R6303:Gm19410	UTSW	8	35807560	missense	possibly damaging	0.96
R6377:Gm19410	UTSW	8	35803582	nonsense	probably null
R6545:Gm19410	UTSW	8	35790498	missense	possibly damaging	0.93
R6700:Gm19410	UTSW	8	35807510	missense	possibly damaging	0.87
R6795:Gm19410	UTSW	8	35795522	missense	probably damaging	0.98
R6808:Gm19410	UTSW	8	35772579	missense	probably damaging	0.99
R6810:Gm19410	UTSW	8	35772579	missense	probably damaging	0.99
R6811:Gm19410	UTSW	8	35772579	missense	probably damaging	0.99
R6966:Gm19410	UTSW	8	35817973	missense	possibly damaging	0.84
R7264:Gm19410	UTSW	8	35785766	missense	probably benign	0.01
R7267:Gm19410	UTSW	8	35814843	missense	possibly damaging	0.80
R7355:Gm19410	UTSW	8	35807072	missense	probably benign	0.00
R7423:Gm19410	UTSW	8	35804607	missense	probably benign	0.28
R7494:Gm19410	UTSW	8	35795530	missense	probably damaging	0.99
R7516:Gm19410	UTSW	8	35796279	missense	probably benign	0.30
R7517:Gm19410	UTSW	8	35773618	missense	possibly damaging	0.45
R7526:Gm19410	UTSW	8	35790612	missense	probably damaging	0.98
R7527:Gm19410	UTSW	8	35802232	missense	probably damaging	0.99
R7545:Gm19410	UTSW	8	35802625	missense	probably damaging	0.99
R7549:Gm19410	UTSW	8	35799346	missense	probably benign	0.20
R7564:Gm19410	UTSW	8	35806997	missense	probably benign	0.00
R7615:Gm19410	UTSW	8	35796359	missense	probably damaging	1.00
R7622:Gm19410	UTSW	8	35810347	missense	possibly damaging	0.91
R7655:Gm19410	UTSW	8	35809099	missense	probably benign
R7656:Gm19410	UTSW	8	35809099	missense	probably benign
R7703:Gm19410	UTSW	8	35799385	missense	probably damaging	0.98
R7750:Gm19410	UTSW	8	35807498	missense	possibly damaging	0.68
R7760:Gm19410	UTSW	8	35802337	missense	probably damaging	0.99
R7837:Gm19410	UTSW	8	35808980	missense	possibly damaging	0.91
R7932:Gm19410	UTSW	8	35795599	missense	probably damaging	0.98
R7942:Gm19410	UTSW	8	35771786	missense	probably damaging	0.98
R7970:Gm19410	UTSW	8	35815647	missense	probably benign	0.00
R8088:Gm19410	UTSW	8	35806841	missense	probably benign	0.45
R8228:Gm19410	UTSW	8	35785838	missense	possibly damaging	0.53
R8382:Gm19410	UTSW	8	35809148	missense	probably damaging	0.99
R8757:Gm19410	UTSW	8	35808965	missense	possibly damaging	0.83
R8879:Gm19410	UTSW	8	35771868	missense	probably damaging	0.99
R9010:Gm19410	UTSW	8	35814857	missense	probably benign	0.02
R9060:Gm19410	UTSW	8	35802326	missense	probably damaging	1.00
R9088:Gm19410	UTSW	8	35773612	missense	probably damaging	1.00
R9104:Gm19410	UTSW	8	35780467	missense	probably damaging	0.99
R9186:Gm19410	UTSW	8	35815475	missense	possibly damaging	0.90
R9290:Gm19410	UTSW	8	35802232	missense	probably damaging	0.99
R9334:Gm19410	UTSW	8	35803568	nonsense	probably null
R9398:Gm19410	UTSW	8	35805202	missense	probably benign	0.00
R9439:Gm19410	UTSW	8	35781656	missense	probably damaging	0.96
R9445:Gm19410	UTSW	8	35772498	missense	possibly damaging	0.75
R9511:Gm19410	UTSW	8	35790694	missense	probably damaging	0.99
R9520:Gm19410	UTSW	8	35795483	missense	probably benign	0.15
R9523:Gm19410	UTSW	8	35790454	missense	probably benign	0.01
R9669:Gm19410	UTSW	8	35780339	missense	possibly damaging	0.45
R9711:Gm19410	UTSW	8	35812339	missense	possibly damaging	0.85
R9728:Gm19410	UTSW	8	35780440	missense	possibly damaging	0.95
R9759:Gm19410	UTSW	8	35785784	missense	possibly damaging	0.53
Z1176:Gm19410	UTSW	8	35792611	missense	possibly damaging	0.79
Z1177:Gm19410	UTSW	8	35808965	missense	possibly damaging	0.83

Predicted Primers

PCR Primer
(F):5'- GGCACCATCTACAGCAATTAAG -3'
(R):5'- TTCAAGGGAAAGAGCCTCCAC -3'

Sequencing Primer
(F):5'- ATGTTAAGCATGCATGAGGCTC -3'
(R):5'- TGGAGACATCTACACTCAGTCAG -3'

Posted On

2018-08-01