Incidental Mutation 'R6720:Olfr890'
ID529543
Institutional Source Beutler Lab
Gene Symbol Olfr890
Ensembl Gene ENSMUSG00000096409
Gene Nameolfactory receptor 890
SynonymsMOR162-3, MOR162-15_p, GA_x6K02T2PVTD-31822365-31823309
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R6720 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location38142517-38148375 bp(+) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) T to A at 38143153 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 1 (M1K)
Ref Sequence ENSEMBL: ENSMUSP00000149829 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079804] [ENSMUST00000213458]
Predicted Effect probably damaging
Transcript: ENSMUST00000079804
AA Change: M6K

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000078733
Gene: ENSMUSG00000096409
AA Change: M6K

DomainStartEndE-ValueType
Pfam:7tm_4 36 311 2.3e-48 PFAM
Pfam:7tm_1 46 293 9.6e-25 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000213458
AA Change: M1K

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Meta Mutation Damage Score 0.9539 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.6%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik G A 4: 137,454,686 E51K possibly damaging Het
Abca1 A C 4: 53,083,733 L700R probably damaging Het
Arpc1a C A 5: 145,101,222 probably null Het
Baz2b G T 2: 59,924,890 P241Q probably damaging Het
Cd6 T A 19: 10,794,609 T414S probably benign Het
Ces2b A T 8: 104,836,869 E409D probably benign Het
Cfap54 A G 10: 92,821,119 Y3024H probably benign Het
Chrm1 A G 19: 8,678,548 T206A probably benign Het
Clptm1l T C 13: 73,618,516 W512R probably damaging Het
Col15a1 T A 4: 47,247,552 probably null Het
Cox15 A G 19: 43,736,789 S392P probably damaging Het
Cr2 T C 1: 195,155,200 M1197V probably damaging Het
Ddx60 A G 8: 62,000,689 K1281E probably benign Het
Dnah11 A G 12: 118,045,646 F2094L probably damaging Het
Ear2 T A 14: 44,102,959 C25S probably damaging Het
Ect2l T C 10: 18,140,264 D802G probably damaging Het
Eftud2 G A 11: 102,838,623 Q84* probably null Het
Eif4g3 T A 4: 138,175,832 probably null Het
Ephb2 T C 4: 136,657,502 D866G probably damaging Het
Fam129b T A 2: 32,905,826 V22D probably damaging Het
Farsb A G 1: 78,472,497 M99T probably damaging Het
Foxs1 T A 2: 152,932,720 S138C probably damaging Het
Frem1 T G 4: 83,013,832 S211R probably damaging Het
Gm19410 G A 8: 35,807,576 R1517Q probably benign Het
Gria2 T C 3: 80,802,304 I27M probably benign Het
H2-Q7 A G 17: 35,442,678 E299G probably benign Het
Hao2 T G 3: 98,877,135 I305L probably benign Het
Hectd4 C T 5: 121,307,381 Q122* probably null Het
Hivep1 T A 13: 42,164,284 C2079S probably damaging Het
Hoxb1 C A 11: 96,366,987 Q248K probably damaging Het
Hspb6 A G 7: 30,554,347 D95G probably benign Het
Ighv5-2 T A 12: 113,578,506 R117S probably damaging Het
Ino80d A C 1: 63,058,610 S708R probably damaging Het
Lman1l A G 9: 57,614,072 probably null Het
Mmp15 A G 8: 95,365,314 N51D probably benign Het
Naip1 T C 13: 100,423,077 M1140V probably benign Het
Olfr1053 A G 2: 86,315,065 S74P probably damaging Het
Olfr1373 A G 11: 52,144,693 V279A probably benign Het
Olfr397 A G 11: 73,965,465 N286D probably damaging Het
Pard3b A T 1: 62,159,470 N239I probably damaging Het
Parvb C T 15: 84,297,979 R237W probably damaging Het
Pcdha9 T C 18: 36,998,069 S64P probably damaging Het
Pdcd1 T C 1: 94,041,389 N68S probably benign Het
Pi4ka G T 16: 17,326,052 probably null Het
Plekha4 A T 7: 45,540,886 D359V possibly damaging Het
Serpinb13 A G 1: 106,994,062 I78V probably benign Het
Slc39a7 T A 17: 34,030,108 T269S probably benign Het
Sltm T G 9: 70,573,710 D281E probably damaging Het
Zfp708 T C 13: 67,071,432 Y76C probably damaging Het
Zfp990 T A 4: 145,536,927 V165D possibly damaging Het
Other mutations in Olfr890
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01505:Olfr890 APN 9 38143871 nonsense probably null
IGL01861:Olfr890 APN 9 38143750 missense probably damaging 1.00
IGL02174:Olfr890 APN 9 38143785 missense possibly damaging 0.90
IGL02723:Olfr890 APN 9 38143411 missense probably benign 0.02
IGL03085:Olfr890 APN 9 38143183 missense probably damaging 0.98
FR4449:Olfr890 UTSW 9 38143188 missense probably benign 0.00
FR4737:Olfr890 UTSW 9 38143188 missense probably benign 0.00
R0637:Olfr890 UTSW 9 38143882 missense probably benign 0.00
R1353:Olfr890 UTSW 9 38143728 missense probably benign 0.03
R1813:Olfr890 UTSW 9 38143729 missense possibly damaging 0.78
R5997:Olfr890 UTSW 9 38143801 missense probably damaging 1.00
R6004:Olfr890 UTSW 9 38143960 missense probably damaging 1.00
R6417:Olfr890 UTSW 9 38143315 missense probably damaging 1.00
R6420:Olfr890 UTSW 9 38143315 missense probably damaging 1.00
R7223:Olfr890 UTSW 9 38143753 missense probably benign 0.02
R7601:Olfr890 UTSW 9 38143378 missense probably benign 0.13
R7671:Olfr890 UTSW 9 38143440 missense probably benign 0.02
R8034:Olfr890 UTSW 9 38143677 missense probably damaging 1.00
Z1176:Olfr890 UTSW 9 38143431 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- ATGGCTGATGTACCTTGTCCC -3'
(R):5'- ACCCACCAGCATTTTGGGTG -3'

Sequencing Primer
(F):5'- CCTTTGAGATTATCACTTGGAAGGC -3'
(R):5'- CCACCAGCATTTTGGGTGTTATGAC -3'
Posted On2018-08-01