Incidental Mutation 'R6720:Ect2l'
ID529546
Institutional Source Beutler Lab
Gene Symbol Ect2l
Ensembl Gene ENSMUSG00000071392
Gene Nameepithelial cell transforming sequence 2 oncogene-like
SynonymsC330021H03Rik, Gm10331
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.126) question?
Stock #R6720 (G1)
Quality Score219.009
Status Validated
Chromosome10
Chromosomal Location18128903-18210890 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 18140264 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 802 (D802G)
Ref Sequence ENSEMBL: ENSMUSP00000146899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095817] [ENSMUST00000207827] [ENSMUST00000208948] [ENSMUST00000209178]
Predicted Effect possibly damaging
Transcript: ENSMUST00000095817
AA Change: D760G

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000093497
Gene: ENSMUSG00000071392
AA Change: D760G

DomainStartEndE-ValueType
FBOX 93 133 3.5e-4 SMART
Pfam:DUF4347 297 468 1.4e-11 PFAM
RhoGEF 578 761 6.3e-46 SMART
Blast:PH 793 909 6e-49 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000207827
AA Change: D760G

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000208948
AA Change: D802G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect possibly damaging
Transcript: ENSMUST00000209178
AA Change: D710G

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215232
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216336
Meta Mutation Damage Score 0.1896 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.6%
Validation Efficiency 98% (50/51)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik G A 4: 137,454,686 E51K possibly damaging Het
Abca1 A C 4: 53,083,733 L700R probably damaging Het
Arpc1a C A 5: 145,101,222 probably null Het
Baz2b G T 2: 59,924,890 P241Q probably damaging Het
Cd6 T A 19: 10,794,609 T414S probably benign Het
Ces2b A T 8: 104,836,869 E409D probably benign Het
Cfap54 A G 10: 92,821,119 Y3024H probably benign Het
Chrm1 A G 19: 8,678,548 T206A probably benign Het
Clptm1l T C 13: 73,618,516 W512R probably damaging Het
Col15a1 T A 4: 47,247,552 probably null Het
Cox15 A G 19: 43,736,789 S392P probably damaging Het
Cr2 T C 1: 195,155,200 M1197V probably damaging Het
Ddx60 A G 8: 62,000,689 K1281E probably benign Het
Dnah11 A G 12: 118,045,646 F2094L probably damaging Het
Ear2 T A 14: 44,102,959 C25S probably damaging Het
Eftud2 G A 11: 102,838,623 Q84* probably null Het
Eif4g3 T A 4: 138,175,832 probably null Het
Ephb2 T C 4: 136,657,502 D866G probably damaging Het
Fam129b T A 2: 32,905,826 V22D probably damaging Het
Farsb A G 1: 78,472,497 M99T probably damaging Het
Foxs1 T A 2: 152,932,720 S138C probably damaging Het
Frem1 T G 4: 83,013,832 S211R probably damaging Het
Gm19410 G A 8: 35,807,576 R1517Q probably benign Het
Gria2 T C 3: 80,802,304 I27M probably benign Het
H2-Q7 A G 17: 35,442,678 E299G probably benign Het
Hao2 T G 3: 98,877,135 I305L probably benign Het
Hectd4 C T 5: 121,307,381 Q122* probably null Het
Hivep1 T A 13: 42,164,284 C2079S probably damaging Het
Hoxb1 C A 11: 96,366,987 Q248K probably damaging Het
Hspb6 A G 7: 30,554,347 D95G probably benign Het
Ighv5-2 T A 12: 113,578,506 R117S probably damaging Het
Ino80d A C 1: 63,058,610 S708R probably damaging Het
Lman1l A G 9: 57,614,072 probably null Het
Mmp15 A G 8: 95,365,314 N51D probably benign Het
Naip1 T C 13: 100,423,077 M1140V probably benign Het
Olfr1053 A G 2: 86,315,065 S74P probably damaging Het
Olfr1373 A G 11: 52,144,693 V279A probably benign Het
Olfr397 A G 11: 73,965,465 N286D probably damaging Het
Olfr890 T A 9: 38,143,153 M1K probably null Het
Pard3b A T 1: 62,159,470 N239I probably damaging Het
Parvb C T 15: 84,297,979 R237W probably damaging Het
Pcdha9 T C 18: 36,998,069 S64P probably damaging Het
Pdcd1 T C 1: 94,041,389 N68S probably benign Het
Pi4ka G T 16: 17,326,052 probably null Het
Plekha4 A T 7: 45,540,886 D359V possibly damaging Het
Serpinb13 A G 1: 106,994,062 I78V probably benign Het
Slc39a7 T A 17: 34,030,108 T269S probably benign Het
Sltm T G 9: 70,573,710 D281E probably damaging Het
Zfp708 T C 13: 67,071,432 Y76C probably damaging Het
Zfp990 T A 4: 145,536,927 V165D possibly damaging Het
Other mutations in Ect2l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01555:Ect2l APN 10 18130730 missense probably damaging 1.00
IGL01773:Ect2l APN 10 18161504 missense probably damaging 0.97
IGL02293:Ect2l APN 10 18140511 critical splice donor site probably null
IGL02589:Ect2l APN 10 18140594 splice site probably benign
IGL02866:Ect2l APN 10 18159817 missense probably damaging 1.00
R0037:Ect2l UTSW 10 18143097 missense probably damaging 1.00
R0526:Ect2l UTSW 10 18199940 missense possibly damaging 0.92
R0628:Ect2l UTSW 10 18143040 missense probably damaging 1.00
R0839:Ect2l UTSW 10 18141904 missense probably benign 0.03
R0948:Ect2l UTSW 10 18140586 missense probably damaging 1.00
R1103:Ect2l UTSW 10 18140526 missense probably damaging 1.00
R1238:Ect2l UTSW 10 18143104 missense possibly damaging 0.94
R1326:Ect2l UTSW 10 18165542 missense probably benign 0.00
R1327:Ect2l UTSW 10 18165542 missense probably benign 0.00
R1544:Ect2l UTSW 10 18168434 missense probably benign 0.04
R1848:Ect2l UTSW 10 18200033 missense probably damaging 1.00
R1921:Ect2l UTSW 10 18143004 missense possibly damaging 0.89
R1938:Ect2l UTSW 10 18144635 missense probably benign 0.00
R2081:Ect2l UTSW 10 18165527 missense probably damaging 1.00
R3551:Ect2l UTSW 10 18163393 missense probably damaging 1.00
R3608:Ect2l UTSW 10 18142940 missense possibly damaging 0.92
R3886:Ect2l UTSW 10 18168458 missense probably damaging 1.00
R4120:Ect2l UTSW 10 18130718 missense probably benign 0.00
R4348:Ect2l UTSW 10 18136988 missense probably damaging 1.00
R4992:Ect2l UTSW 10 18172729 missense probably benign 0.00
R5053:Ect2l UTSW 10 18140345 missense probably damaging 1.00
R5144:Ect2l UTSW 10 18144577 missense probably benign 0.03
R5654:Ect2l UTSW 10 18143062 missense probably damaging 0.99
R5779:Ect2l UTSW 10 18163438 missense probably benign 0.09
R5814:Ect2l UTSW 10 18200009 missense probably damaging 0.97
R6053:Ect2l UTSW 10 18141844 missense probably damaging 1.00
R6057:Ect2l UTSW 10 18161502 missense probably benign 0.02
R6244:Ect2l UTSW 10 18140397 missense possibly damaging 0.93
R6817:Ect2l UTSW 10 18174059 missense probably benign 0.00
R6894:Ect2l UTSW 10 18169380 critical splice donor site probably null
R7199:Ect2l UTSW 10 18129146 missense probably benign 0.02
R7313:Ect2l UTSW 10 18168401 missense probably damaging 0.98
R7404:Ect2l UTSW 10 18159781 missense probably damaging 0.99
R7482:Ect2l UTSW 10 18168454 missense probably benign 0.07
R7751:Ect2l UTSW 10 18169405 missense possibly damaging 0.82
R7752:Ect2l UTSW 10 18141964 missense possibly damaging 0.94
R7880:Ect2l UTSW 10 18136954 missense possibly damaging 0.60
R7901:Ect2l UTSW 10 18141964 missense possibly damaging 0.94
R8138:Ect2l UTSW 10 18169405 missense probably damaging 0.96
X0018:Ect2l UTSW 10 18130652 missense probably benign 0.02
Z1177:Ect2l UTSW 10 18172672 missense probably null 0.71
Predicted Primers PCR Primer
(F):5'- ACCATTGCTTGACATTGTTTGG -3'
(R):5'- TGGCCTACAGGTAGCAATGAG -3'

Sequencing Primer
(F):5'- GGCTTGAAATAGATGCCCTTC -3'
(R):5'- CCTACAGGTAGCAATGAGGGCAC -3'
Posted On2018-08-01