Incidental Mutation 'R6720:Olfr397'
ID529549
Institutional Source Beutler Lab
Gene Symbol Olfr397
Ensembl Gene ENSMUSG00000057050
Gene Nameolfactory receptor 397
SynonymsGA_x6K02T2P1NL-4121434-4122381, MOR135-28
MMRRC Submission
Accession Numbers

Genbank: NM_146346; MGI: 3030231

Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R6720 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location73960817-73967812 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 73965465 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 286 (N286D)
Ref Sequence ENSEMBL: ENSMUSP00000150172 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000121280] [ENSMUST00000213134] [ENSMUST00000216291]
Predicted Effect probably damaging
Transcript: ENSMUST00000121280
AA Change: N286D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113870
Gene: ENSMUSG00000057050
AA Change: N286D

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 35 305 1.3e-6 PFAM
Pfam:7tm_1 41 290 4.3e-35 PFAM
Pfam:7tm_4 139 283 1.2e-44 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213134
AA Change: N286D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215020
Predicted Effect probably damaging
Transcript: ENSMUST00000216291
AA Change: N286D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.6052 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.6%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik G A 4: 137,454,686 E51K possibly damaging Het
Abca1 A C 4: 53,083,733 L700R probably damaging Het
Arpc1a C A 5: 145,101,222 probably null Het
Baz2b G T 2: 59,924,890 P241Q probably damaging Het
Cd6 T A 19: 10,794,609 T414S probably benign Het
Ces2b A T 8: 104,836,869 E409D probably benign Het
Cfap54 A G 10: 92,821,119 Y3024H probably benign Het
Chrm1 A G 19: 8,678,548 T206A probably benign Het
Clptm1l T C 13: 73,618,516 W512R probably damaging Het
Col15a1 T A 4: 47,247,552 probably null Het
Cox15 A G 19: 43,736,789 S392P probably damaging Het
Cr2 T C 1: 195,155,200 M1197V probably damaging Het
Ddx60 A G 8: 62,000,689 K1281E probably benign Het
Dnah11 A G 12: 118,045,646 F2094L probably damaging Het
Ear2 T A 14: 44,102,959 C25S probably damaging Het
Ect2l T C 10: 18,140,264 D802G probably damaging Het
Eftud2 G A 11: 102,838,623 Q84* probably null Het
Eif4g3 T A 4: 138,175,832 probably null Het
Ephb2 T C 4: 136,657,502 D866G probably damaging Het
Fam129b T A 2: 32,905,826 V22D probably damaging Het
Farsb A G 1: 78,472,497 M99T probably damaging Het
Foxs1 T A 2: 152,932,720 S138C probably damaging Het
Frem1 T G 4: 83,013,832 S211R probably damaging Het
Gm19410 G A 8: 35,807,576 R1517Q probably benign Het
Gria2 T C 3: 80,802,304 I27M probably benign Het
H2-Q7 A G 17: 35,442,678 E299G probably benign Het
Hao2 T G 3: 98,877,135 I305L probably benign Het
Hectd4 C T 5: 121,307,381 Q122* probably null Het
Hivep1 T A 13: 42,164,284 C2079S probably damaging Het
Hoxb1 C A 11: 96,366,987 Q248K probably damaging Het
Hspb6 A G 7: 30,554,347 D95G probably benign Het
Ighv5-2 T A 12: 113,578,506 R117S probably damaging Het
Ino80d A C 1: 63,058,610 S708R probably damaging Het
Lman1l A G 9: 57,614,072 probably null Het
Mmp15 A G 8: 95,365,314 N51D probably benign Het
Naip1 T C 13: 100,423,077 M1140V probably benign Het
Olfr1053 A G 2: 86,315,065 S74P probably damaging Het
Olfr1373 A G 11: 52,144,693 V279A probably benign Het
Olfr890 T A 9: 38,143,153 M1K probably null Het
Pard3b A T 1: 62,159,470 N239I probably damaging Het
Parvb C T 15: 84,297,979 R237W probably damaging Het
Pcdha9 T C 18: 36,998,069 S64P probably damaging Het
Pdcd1 T C 1: 94,041,389 N68S probably benign Het
Pi4ka G T 16: 17,326,052 probably null Het
Plekha4 A T 7: 45,540,886 D359V possibly damaging Het
Serpinb13 A G 1: 106,994,062 I78V probably benign Het
Slc39a7 T A 17: 34,030,108 T269S probably benign Het
Sltm T G 9: 70,573,710 D281E probably damaging Het
Zfp708 T C 13: 67,071,432 Y76C probably damaging Het
Zfp990 T A 4: 145,536,927 V165D possibly damaging Het
Other mutations in Olfr397
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01797:Olfr397 APN 11 73964818 missense probably damaging 1.00
IGL01839:Olfr397 APN 11 73964611 start codon destroyed probably null 1.00
IGL02247:Olfr397 APN 11 73964862 missense probably benign 0.05
IGL02876:Olfr397 APN 11 73964713 missense possibly damaging 0.95
IGL03051:Olfr397 APN 11 73965034 missense probably benign 0.04
IGL03123:Olfr397 APN 11 73964986 missense probably damaging 1.00
IGL03401:Olfr397 APN 11 73965562 utr 3 prime probably benign
3-1:Olfr397 UTSW 11 73964977 missense possibly damaging 0.84
R0496:Olfr397 UTSW 11 73964880 missense probably benign 0.42
R0811:Olfr397 UTSW 11 73965420 missense probably benign 0.02
R0812:Olfr397 UTSW 11 73965420 missense probably benign 0.02
R1503:Olfr397 UTSW 11 73964568 utr 5 prime probably null
R2067:Olfr397 UTSW 11 73964914 missense probably damaging 1.00
R2111:Olfr397 UTSW 11 73964914 missense probably damaging 1.00
R4912:Olfr397 UTSW 11 73965340 missense probably damaging 1.00
R5240:Olfr397 UTSW 11 73964806 missense probably damaging 1.00
R5656:Olfr397 UTSW 11 73964710 missense probably damaging 0.99
R5801:Olfr397 UTSW 11 73964946 missense probably benign 0.39
R6329:Olfr397 UTSW 11 73964742 missense possibly damaging 0.73
R7149:Olfr397 UTSW 11 73965431 missense probably benign 0.01
R7283:Olfr397 UTSW 11 73964808 missense probably damaging 1.00
Z1176:Olfr397 UTSW 11 73965297 frame shift probably null
Z1177:Olfr397 UTSW 11 73964760 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGTCCCCTCTTCTAGAAGCATC -3'
(R):5'- TGTCACACCTGAAGTATAGTGC -3'

Sequencing Primer
(F):5'- TCTTCTAGAAGCATCCGCAAG -3'
(R):5'- AGTGCTAAATTTAAGTGGCATGAG -3'
Posted On2018-08-01