Mutagenetix > Incidental Mutations

Incidental Mutation 'R6720:Olfr397'

529549

Institutional Source

Beutler Lab

Gene Symbol

Olfr397

Ensembl Gene

ENSMUSG00000057050

Gene Name

olfactory receptor 397

Synonyms

GA_x6K02T2P1NL-4121434-4122381, MOR135-28

MMRRC Submission

Accession Numbers

Genbank: NM_146346; MGI: 3030231

Is this an essential gene?

Probably non essential (E-score: 0.070) question?

Stock #

R6720 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

73960817-73967812 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 73965465 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Aspartic acid at position 286 (N286D)

Ref Sequence

ENSEMBL: ENSMUSP00000150172 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000121280] [ENSMUST00000213134] [ENSMUST00000216291]

Predicted Effect

probably damaging
Transcript: ENSMUST00000121280
AA Change: N286D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000113870
Gene: ENSMUSG00000057050
AA Change: N286D

Domain	Start	End	E-Value	Type
Pfam:7TM_GPCR_Srsx	35	305	1.3e-6	PFAM
Pfam:7tm_1	41	290	4.3e-35	PFAM
Pfam:7tm_4	139	283	1.2e-44	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000213134
AA Change: N286D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000215020

Predicted Effect

probably damaging
Transcript: ENSMUST00000216291
AA Change: N286D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Meta Mutation Damage Score

0.6052

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.7%
20x: 93.6%

Validation Efficiency

98% (50/51)

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700013G24Rik	G	A	4: 137,454,686	E51K	possibly damaging	Het
Abca1	A	C	4: 53,083,733	L700R	probably damaging	Het
Arpc1a	C	A	5: 145,101,222		probably null	Het
Baz2b	G	T	2: 59,924,890	P241Q	probably damaging	Het
Cd6	T	A	19: 10,794,609	T414S	probably benign	Het
Ces2b	A	T	8: 104,836,869	E409D	probably benign	Het
Cfap54	A	G	10: 92,821,119	Y3024H	probably benign	Het
Chrm1	A	G	19: 8,678,548	T206A	probably benign	Het
Clptm1l	T	C	13: 73,618,516	W512R	probably damaging	Het
Col15a1	T	A	4: 47,247,552		probably null	Het
Cox15	A	G	19: 43,736,789	S392P	probably damaging	Het
Cr2	T	C	1: 195,155,200	M1197V	probably damaging	Het
Ddx60	A	G	8: 62,000,689	K1281E	probably benign	Het
Dnah11	A	G	12: 118,045,646	F2094L	probably damaging	Het
Ear2	T	A	14: 44,102,959	C25S	probably damaging	Het
Ect2l	T	C	10: 18,140,264	D802G	probably damaging	Het
Eftud2	G	A	11: 102,838,623	Q84*	probably null	Het
Eif4g3	T	A	4: 138,175,832		probably null	Het
Ephb2	T	C	4: 136,657,502	D866G	probably damaging	Het
Fam129b	T	A	2: 32,905,826	V22D	probably damaging	Het
Farsb	A	G	1: 78,472,497	M99T	probably damaging	Het
Foxs1	T	A	2: 152,932,720	S138C	probably damaging	Het
Frem1	T	G	4: 83,013,832	S211R	probably damaging	Het
Gm19410	G	A	8: 35,807,576	R1517Q	probably benign	Het
Gria2	T	C	3: 80,802,304	I27M	probably benign	Het
H2-Q7	A	G	17: 35,442,678	E299G	probably benign	Het
Hao2	T	G	3: 98,877,135	I305L	probably benign	Het
Hectd4	C	T	5: 121,307,381	Q122*	probably null	Het
Hivep1	T	A	13: 42,164,284	C2079S	probably damaging	Het
Hoxb1	C	A	11: 96,366,987	Q248K	probably damaging	Het
Hspb6	A	G	7: 30,554,347	D95G	probably benign	Het
Ighv5-2	T	A	12: 113,578,506	R117S	probably damaging	Het
Ino80d	A	C	1: 63,058,610	S708R	probably damaging	Het
Lman1l	A	G	9: 57,614,072		probably null	Het
Mmp15	A	G	8: 95,365,314	N51D	probably benign	Het
Naip1	T	C	13: 100,423,077	M1140V	probably benign	Het
Olfr1053	A	G	2: 86,315,065	S74P	probably damaging	Het
Olfr1373	A	G	11: 52,144,693	V279A	probably benign	Het
Olfr890	T	A	9: 38,143,153	M1K	probably null	Het
Pard3b	A	T	1: 62,159,470	N239I	probably damaging	Het
Parvb	C	T	15: 84,297,979	R237W	probably damaging	Het
Pcdha9	T	C	18: 36,998,069	S64P	probably damaging	Het
Pdcd1	T	C	1: 94,041,389	N68S	probably benign	Het
Pi4ka	G	T	16: 17,326,052		probably null	Het
Plekha4	A	T	7: 45,540,886	D359V	possibly damaging	Het
Serpinb13	A	G	1: 106,994,062	I78V	probably benign	Het
Slc39a7	T	A	17: 34,030,108	T269S	probably benign	Het
Sltm	T	G	9: 70,573,710	D281E	probably damaging	Het
Zfp708	T	C	13: 67,071,432	Y76C	probably damaging	Het
Zfp990	T	A	4: 145,536,927	V165D	possibly damaging	Het

Other mutations in Olfr397

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01797:Olfr397	APN	11	73964818	missense	probably damaging	1.00
IGL01839:Olfr397	APN	11	73964611	start codon destroyed	probably null	1.00
IGL02247:Olfr397	APN	11	73964862	missense	probably benign	0.05
IGL02876:Olfr397	APN	11	73964713	missense	possibly damaging	0.95
IGL03051:Olfr397	APN	11	73965034	missense	probably benign	0.04
IGL03123:Olfr397	APN	11	73964986	missense	probably damaging	1.00
IGL03401:Olfr397	APN	11	73965562	utr 3 prime	probably benign
3-1:Olfr397	UTSW	11	73964977	missense	possibly damaging	0.84
R0496:Olfr397	UTSW	11	73964880	missense	probably benign	0.42
R0811:Olfr397	UTSW	11	73965420	missense	probably benign	0.02
R0812:Olfr397	UTSW	11	73965420	missense	probably benign	0.02
R1503:Olfr397	UTSW	11	73964568	utr 5 prime	probably null
R2067:Olfr397	UTSW	11	73964914	missense	probably damaging	1.00
R2111:Olfr397	UTSW	11	73964914	missense	probably damaging	1.00
R4912:Olfr397	UTSW	11	73965340	missense	probably damaging	1.00
R5240:Olfr397	UTSW	11	73964806	missense	probably damaging	1.00
R5656:Olfr397	UTSW	11	73964710	missense	probably damaging	0.99
R5801:Olfr397	UTSW	11	73964946	missense	probably benign	0.39
R6329:Olfr397	UTSW	11	73964742	missense	possibly damaging	0.73
R7149:Olfr397	UTSW	11	73965431	missense	probably benign	0.01
R7283:Olfr397	UTSW	11	73964808	missense	probably damaging	1.00
R8194:Olfr397	UTSW	11	73965414	missense	probably benign	0.00
R8466:Olfr397	UTSW	11	73965087	missense	probably damaging	1.00
R8472:Olfr397	UTSW	11	73965397	missense	possibly damaging	0.78
Z1176:Olfr397	UTSW	11	73965297	frame shift	probably null
Z1177:Olfr397	UTSW	11	73964760	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGGTCCCCTCTTCTAGAAGCATC -3'
(R):5'- TGTCACACCTGAAGTATAGTGC -3'

Sequencing Primer
(F):5'- TCTTCTAGAAGCATCCGCAAG -3'
(R):5'- AGTGCTAAATTTAAGTGGCATGAG -3'

Posted On

2018-08-01