Incidental Mutation 'R6720:Hoxb1'
ID529550
Institutional Source Beutler Lab
Gene Symbol Hoxb1
Ensembl Gene ENSMUSG00000018973
Gene Namehomeobox B1
SynonymsHox-2.9
MMRRC Submission
Accession Numbers

Genbank: NM_008266; MGI: 96182

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6720 (G1)
Quality Score217.009
Status Validated
Chromosome11
Chromosomal Location96365752-96368256 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 96366987 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 248 (Q248K)
Ref Sequence ENSEMBL: ENSMUSP00000019117 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019117]
Predicted Effect probably damaging
Transcript: ENSMUST00000019117
AA Change: Q248K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000019117
Gene: ENSMUSG00000018973
AA Change: Q248K

DomainStartEndE-ValueType
low complexity region 72 85 N/A INTRINSIC
low complexity region 124 142 N/A INTRINSIC
HOX 199 261 6.97e-26 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123805
Meta Mutation Damage Score 0.7463 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.6%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the homeobox family of genes. The homeobox genes encode a highly conserved family of transcription factors that play an important role in morphogenesis in all multicellular organisms. Mammals possess four similar homeobox gene clusters, HOXA, HOXB, HOXC and HOXD, located on different chromosomes, consisting of 9 to 11 genes arranged in tandem. This gene is one of several homeobox HOXB genes located in a cluster on chromosome 17. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a reporter allele die neonatally with altered segmental identity and abnormal migration of motor neurons in the hindbrain. Mice homozygous for null alleles can exhibit partial postnatal lethality, narrow face, runting, absent facial motor nuclei, and facial nerve/muscle defects. [provided by MGI curators]
Allele List at MGI

All alleles(12) : Targeted, knock-out(2) Targeted, other(10)

Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik G A 4: 137,454,686 E51K possibly damaging Het
Abca1 A C 4: 53,083,733 L700R probably damaging Het
Arpc1a C A 5: 145,101,222 probably null Het
Baz2b G T 2: 59,924,890 P241Q probably damaging Het
Cd6 T A 19: 10,794,609 T414S probably benign Het
Ces2b A T 8: 104,836,869 E409D probably benign Het
Cfap54 A G 10: 92,821,119 Y3024H probably benign Het
Chrm1 A G 19: 8,678,548 T206A probably benign Het
Clptm1l T C 13: 73,618,516 W512R probably damaging Het
Col15a1 T A 4: 47,247,552 probably null Het
Cox15 A G 19: 43,736,789 S392P probably damaging Het
Cr2 T C 1: 195,155,200 M1197V probably damaging Het
Ddx60 A G 8: 62,000,689 K1281E probably benign Het
Dnah11 A G 12: 118,045,646 F2094L probably damaging Het
Ear2 T A 14: 44,102,959 C25S probably damaging Het
Ect2l T C 10: 18,140,264 D802G probably damaging Het
Eftud2 G A 11: 102,838,623 Q84* probably null Het
Eif4g3 T A 4: 138,175,832 probably null Het
Ephb2 T C 4: 136,657,502 D866G probably damaging Het
Fam129b T A 2: 32,905,826 V22D probably damaging Het
Farsb A G 1: 78,472,497 M99T probably damaging Het
Foxs1 T A 2: 152,932,720 S138C probably damaging Het
Frem1 T G 4: 83,013,832 S211R probably damaging Het
Gm19410 G A 8: 35,807,576 R1517Q probably benign Het
Gria2 T C 3: 80,802,304 I27M probably benign Het
H2-Q7 A G 17: 35,442,678 E299G probably benign Het
Hao2 T G 3: 98,877,135 I305L probably benign Het
Hectd4 C T 5: 121,307,381 Q122* probably null Het
Hivep1 T A 13: 42,164,284 C2079S probably damaging Het
Hspb6 A G 7: 30,554,347 D95G probably benign Het
Ighv5-2 T A 12: 113,578,506 R117S probably damaging Het
Ino80d A C 1: 63,058,610 S708R probably damaging Het
Lman1l A G 9: 57,614,072 probably null Het
Mmp15 A G 8: 95,365,314 N51D probably benign Het
Naip1 T C 13: 100,423,077 M1140V probably benign Het
Olfr1053 A G 2: 86,315,065 S74P probably damaging Het
Olfr1373 A G 11: 52,144,693 V279A probably benign Het
Olfr397 A G 11: 73,965,465 N286D probably damaging Het
Olfr890 T A 9: 38,143,153 M1K probably null Het
Pard3b A T 1: 62,159,470 N239I probably damaging Het
Parvb C T 15: 84,297,979 R237W probably damaging Het
Pcdha9 T C 18: 36,998,069 S64P probably damaging Het
Pdcd1 T C 1: 94,041,389 N68S probably benign Het
Pi4ka G T 16: 17,326,052 probably null Het
Plekha4 A T 7: 45,540,886 D359V possibly damaging Het
Serpinb13 A G 1: 106,994,062 I78V probably benign Het
Slc39a7 T A 17: 34,030,108 T269S probably benign Het
Sltm T G 9: 70,573,710 D281E probably damaging Het
Zfp708 T C 13: 67,071,432 Y76C probably damaging Het
Zfp990 T A 4: 145,536,927 V165D possibly damaging Het
Other mutations in Hoxb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
F6893:Hoxb1 UTSW 11 96365902 missense probably benign 0.04
R1921:Hoxb1 UTSW 11 96366112 missense probably damaging 0.99
R2352:Hoxb1 UTSW 11 96366377 missense possibly damaging 0.81
R2921:Hoxb1 UTSW 11 96366293 missense probably benign 0.30
R2922:Hoxb1 UTSW 11 96366293 missense probably benign 0.30
R2923:Hoxb1 UTSW 11 96366293 missense probably benign 0.30
R5530:Hoxb1 UTSW 11 96366928 missense probably damaging 1.00
R5715:Hoxb1 UTSW 11 96366326 missense probably benign 0.00
R6400:Hoxb1 UTSW 11 96365992 nonsense probably null
R7311:Hoxb1 UTSW 11 96367101 missense possibly damaging 0.47
Z1176:Hoxb1 UTSW 11 96367051 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AGAGAACTGACGTGGCTTTTC -3'
(R):5'- CGTTGGAAGCCCAGTTACTTAG -3'

Sequencing Primer
(F):5'- CCTAGCGAAGGTGTCCGAG -3'
(R):5'- TGGAAGCCCAGTTACTTAGGAAGTTC -3'
Posted On2018-08-01