Incidental Mutation 'R6720:Zfp708'
ID529555
Institutional Source Beutler Lab
Gene Symbol Zfp708
Ensembl Gene ENSMUSG00000058883
Gene Namezinc finger protein 708
Synonyms
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_001012325.2, NM_001012448.2, NM_001012449.2; MGI:3040674

Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R6720 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location67069399-67097976 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 67071432 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 76 (Y76C)
Ref Sequence ENSEMBL: ENSMUSP00000139928 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109742] [ENSMUST00000109743] [ENSMUST00000186303] [ENSMUST00000190566]
Predicted Effect possibly damaging
Transcript: ENSMUST00000109742
AA Change: Y109C

PolyPhen 2 Score 0.489 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000105364
Gene: ENSMUSG00000058883
AA Change: Y109C

DomainStartEndE-ValueType
KRAB 5 65 3.75e-28 SMART
ZnF_C2H2 81 103 1.12e-3 SMART
ZnF_C2H2 109 131 5.14e-3 SMART
ZnF_C2H2 137 159 1.1e-2 SMART
ZnF_C2H2 165 187 6.78e-3 SMART
ZnF_C2H2 193 215 1.47e-3 SMART
ZnF_C2H2 221 243 7.78e-3 SMART
ZnF_C2H2 249 271 1.95e-3 SMART
ZnF_C2H2 277 299 5.21e-4 SMART
ZnF_C2H2 305 327 7.9e-4 SMART
ZnF_C2H2 333 355 8.34e-3 SMART
ZnF_C2H2 361 383 1.3e-4 SMART
ZnF_C2H2 389 411 4.87e-4 SMART
ZnF_C2H2 417 439 5.14e-3 SMART
ZnF_C2H2 445 467 1.2e-3 SMART
ZnF_C2H2 473 495 1.72e-4 SMART
ZnF_C2H2 501 523 1.6e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000109743
AA Change: Y121C

PolyPhen 2 Score 0.869 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000105365
Gene: ENSMUSG00000058883
AA Change: Y121C

DomainStartEndE-ValueType
KRAB 17 77 3.75e-28 SMART
ZnF_C2H2 93 115 1.12e-3 SMART
ZnF_C2H2 121 143 5.14e-3 SMART
ZnF_C2H2 149 171 1.1e-2 SMART
ZnF_C2H2 177 199 6.78e-3 SMART
ZnF_C2H2 205 227 1.47e-3 SMART
ZnF_C2H2 233 255 7.78e-3 SMART
ZnF_C2H2 261 283 1.95e-3 SMART
ZnF_C2H2 289 311 5.21e-4 SMART
ZnF_C2H2 317 339 7.9e-4 SMART
ZnF_C2H2 345 367 8.34e-3 SMART
ZnF_C2H2 373 395 1.3e-4 SMART
ZnF_C2H2 401 423 4.87e-4 SMART
ZnF_C2H2 429 451 5.14e-3 SMART
ZnF_C2H2 457 479 1.2e-3 SMART
ZnF_C2H2 485 507 1.72e-4 SMART
ZnF_C2H2 513 535 1.6e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185856
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185954
Predicted Effect probably benign
Transcript: ENSMUST00000186303
SMART Domains Protein: ENSMUSP00000140296
Gene: ENSMUSG00000100235

DomainStartEndE-ValueType
KRAB 1 32 9.7e-3 SMART
ZnF_C2H2 47 69 1.8e-6 SMART
ZnF_C2H2 75 97 6.7e-5 SMART
ZnF_C2H2 103 125 7.6e-6 SMART
ZnF_C2H2 131 153 7.6e-6 SMART
ZnF_C2H2 159 181 1.4e-7 SMART
ZnF_C2H2 187 209 7.6e-6 SMART
ZnF_C2H2 215 237 5.5e-5 SMART
ZnF_C2H2 243 265 8.9e-7 SMART
ZnF_C2H2 271 293 2e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000190566
AA Change: Y76C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139928
Gene: ENSMUSG00000058883
AA Change: Y76C

DomainStartEndE-ValueType
KRAB 1 32 1.6e-3 SMART
ZnF_C2H2 48 70 4.7e-6 SMART
ZnF_C2H2 76 98 2.1e-5 SMART
ZnF_C2H2 104 126 4.6e-5 SMART
ZnF_C2H2 132 154 2.9e-5 SMART
ZnF_C2H2 160 182 6.3e-6 SMART
ZnF_C2H2 188 210 3.3e-5 SMART
ZnF_C2H2 216 238 8.2e-6 SMART
ZnF_C2H2 244 266 2.2e-6 SMART
ZnF_C2H2 272 294 3.4e-6 SMART
ZnF_C2H2 300 322 3.6e-5 SMART
ZnF_C2H2 328 350 5.5e-7 SMART
ZnF_C2H2 356 378 2.1e-6 SMART
ZnF_C2H2 384 406 2.1e-5 SMART
ZnF_C2H2 412 434 5e-6 SMART
ZnF_C2H2 440 462 7.2e-7 SMART
ZnF_C2H2 468 490 6.8e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223556
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223904
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224641
Meta Mutation Damage Score 0.5431 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.6%
Validation Efficiency 98% (50/51)
Allele List at MGI

All alleles(1) : Targeted(1)

Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik G A 4: 137,454,686 E51K possibly damaging Het
Abca1 A C 4: 53,083,733 L700R probably damaging Het
Arpc1a C A 5: 145,101,222 probably null Het
Baz2b G T 2: 59,924,890 P241Q probably damaging Het
Cd6 T A 19: 10,794,609 T414S probably benign Het
Ces2b A T 8: 104,836,869 E409D probably benign Het
Cfap54 A G 10: 92,821,119 Y3024H probably benign Het
Chrm1 A G 19: 8,678,548 T206A probably benign Het
Clptm1l T C 13: 73,618,516 W512R probably damaging Het
Col15a1 T A 4: 47,247,552 probably null Het
Cox15 A G 19: 43,736,789 S392P probably damaging Het
Cr2 T C 1: 195,155,200 M1197V probably damaging Het
Ddx60 A G 8: 62,000,689 K1281E probably benign Het
Dnah11 A G 12: 118,045,646 F2094L probably damaging Het
Ear2 T A 14: 44,102,959 C25S probably damaging Het
Ect2l T C 10: 18,140,264 D802G probably damaging Het
Eftud2 G A 11: 102,838,623 Q84* probably null Het
Eif4g3 T A 4: 138,175,832 probably null Het
Ephb2 T C 4: 136,657,502 D866G probably damaging Het
Fam129b T A 2: 32,905,826 V22D probably damaging Het
Farsb A G 1: 78,472,497 M99T probably damaging Het
Foxs1 T A 2: 152,932,720 S138C probably damaging Het
Frem1 T G 4: 83,013,832 S211R probably damaging Het
Gm19410 G A 8: 35,807,576 R1517Q probably benign Het
Gria2 T C 3: 80,802,304 I27M probably benign Het
H2-Q7 A G 17: 35,442,678 E299G probably benign Het
Hao2 T G 3: 98,877,135 I305L probably benign Het
Hectd4 C T 5: 121,307,381 Q122* probably null Het
Hivep1 T A 13: 42,164,284 C2079S probably damaging Het
Hoxb1 C A 11: 96,366,987 Q248K probably damaging Het
Hspb6 A G 7: 30,554,347 D95G probably benign Het
Ighv5-2 T A 12: 113,578,506 R117S probably damaging Het
Ino80d A C 1: 63,058,610 S708R probably damaging Het
Lman1l A G 9: 57,614,072 probably null Het
Mmp15 A G 8: 95,365,314 N51D probably benign Het
Naip1 T C 13: 100,423,077 M1140V probably benign Het
Olfr1053 A G 2: 86,315,065 S74P probably damaging Het
Olfr1373 A G 11: 52,144,693 V279A probably benign Het
Olfr397 A G 11: 73,965,465 N286D probably damaging Het
Olfr890 T A 9: 38,143,153 M1K probably null Het
Pard3b A T 1: 62,159,470 N239I probably damaging Het
Parvb C T 15: 84,297,979 R237W probably damaging Het
Pcdha9 T C 18: 36,998,069 S64P probably damaging Het
Pdcd1 T C 1: 94,041,389 N68S probably benign Het
Pi4ka G T 16: 17,326,052 probably null Het
Plekha4 A T 7: 45,540,886 D359V possibly damaging Het
Serpinb13 A G 1: 106,994,062 I78V probably benign Het
Slc39a7 T A 17: 34,030,108 T269S probably benign Het
Sltm T G 9: 70,573,710 D281E probably damaging Het
Zfp990 T A 4: 145,536,927 V165D possibly damaging Het
Other mutations in Zfp708
AlleleSourceChrCoordTypePredicted EffectPPH Score
P0024:Zfp708 UTSW 13 67070920 nonsense probably null
R0611:Zfp708 UTSW 13 67070311 missense probably benign 0.18
R0627:Zfp708 UTSW 13 67070717 nonsense probably null
R1019:Zfp708 UTSW 13 67074098 missense probably benign 0.05
R2230:Zfp708 UTSW 13 67070972 nonsense probably null
R2512:Zfp708 UTSW 13 67071187 missense probably damaging 1.00
R5718:Zfp708 UTSW 13 67070458 missense probably benign 0.44
R6128:Zfp708 UTSW 13 67074901 missense probably damaging 1.00
R6644:Zfp708 UTSW 13 67070721 missense possibly damaging 0.88
R7082:Zfp708 UTSW 13 67071136 missense possibly damaging 0.60
R7885:Zfp708 UTSW 13 67074129 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTCATCGCATTTATAGGGTTTCTC -3'
(R):5'- ATGAGGCTACTGGGAATATAGTATG -3'

Sequencing Primer
(F):5'- CTCTTCCCTATGAATTTGTTGGTG -3'
(R):5'- GCTACTGGGAATATAGTATGCAAATG -3'
Posted On2018-08-01