Incidental Mutation 'R6720:Clptm1l'
ID529556
Institutional Source Beutler Lab
Gene Symbol Clptm1l
Ensembl Gene ENSMUSG00000021610
Gene NameCLPTM1-like
SynonymsC130052I12Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6720 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location73604006-73620605 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 73618516 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 512 (W512R)
Ref Sequence ENSEMBL: ENSMUSP00000022102 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022102]
Predicted Effect probably damaging
Transcript: ENSMUST00000022102
AA Change: W512R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022102
Gene: ENSMUSG00000021610
AA Change: W512R

DomainStartEndE-ValueType
Pfam:CLPTM1 10 423 3.2e-134 PFAM
transmembrane domain 428 450 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221130
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221417
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222343
Meta Mutation Damage Score 0.8947 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.6%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane protein whose overexpression in cisplatin-sensitive cells causes apoptosis. Polymorphisms in this gene have been reported to increase susceptibility to several cancers, including lung, pancreatic, and breast cancers. [provided by RefSeq, Nov 2015]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik G A 4: 137,454,686 E51K possibly damaging Het
Abca1 A C 4: 53,083,733 L700R probably damaging Het
Arpc1a C A 5: 145,101,222 probably null Het
Baz2b G T 2: 59,924,890 P241Q probably damaging Het
Cd6 T A 19: 10,794,609 T414S probably benign Het
Ces2b A T 8: 104,836,869 E409D probably benign Het
Cfap54 A G 10: 92,821,119 Y3024H probably benign Het
Chrm1 A G 19: 8,678,548 T206A probably benign Het
Col15a1 T A 4: 47,247,552 probably null Het
Cox15 A G 19: 43,736,789 S392P probably damaging Het
Cr2 T C 1: 195,155,200 M1197V probably damaging Het
Ddx60 A G 8: 62,000,689 K1281E probably benign Het
Dnah11 A G 12: 118,045,646 F2094L probably damaging Het
Ear2 T A 14: 44,102,959 C25S probably damaging Het
Ect2l T C 10: 18,140,264 D802G probably damaging Het
Eftud2 G A 11: 102,838,623 Q84* probably null Het
Eif4g3 T A 4: 138,175,832 probably null Het
Ephb2 T C 4: 136,657,502 D866G probably damaging Het
Fam129b T A 2: 32,905,826 V22D probably damaging Het
Farsb A G 1: 78,472,497 M99T probably damaging Het
Foxs1 T A 2: 152,932,720 S138C probably damaging Het
Frem1 T G 4: 83,013,832 S211R probably damaging Het
Gm19410 G A 8: 35,807,576 R1517Q probably benign Het
Gria2 T C 3: 80,802,304 I27M probably benign Het
H2-Q7 A G 17: 35,442,678 E299G probably benign Het
Hao2 T G 3: 98,877,135 I305L probably benign Het
Hectd4 C T 5: 121,307,381 Q122* probably null Het
Hivep1 T A 13: 42,164,284 C2079S probably damaging Het
Hoxb1 C A 11: 96,366,987 Q248K probably damaging Het
Hspb6 A G 7: 30,554,347 D95G probably benign Het
Ighv5-2 T A 12: 113,578,506 R117S probably damaging Het
Ino80d A C 1: 63,058,610 S708R probably damaging Het
Lman1l A G 9: 57,614,072 probably null Het
Mmp15 A G 8: 95,365,314 N51D probably benign Het
Naip1 T C 13: 100,423,077 M1140V probably benign Het
Olfr1053 A G 2: 86,315,065 S74P probably damaging Het
Olfr1373 A G 11: 52,144,693 V279A probably benign Het
Olfr397 A G 11: 73,965,465 N286D probably damaging Het
Olfr890 T A 9: 38,143,153 M1K probably null Het
Pard3b A T 1: 62,159,470 N239I probably damaging Het
Parvb C T 15: 84,297,979 R237W probably damaging Het
Pcdha9 T C 18: 36,998,069 S64P probably damaging Het
Pdcd1 T C 1: 94,041,389 N68S probably benign Het
Pi4ka G T 16: 17,326,052 probably null Het
Plekha4 A T 7: 45,540,886 D359V possibly damaging Het
Serpinb13 A G 1: 106,994,062 I78V probably benign Het
Slc39a7 T A 17: 34,030,108 T269S probably benign Het
Sltm T G 9: 70,573,710 D281E probably damaging Het
Zfp708 T C 13: 67,071,432 Y76C probably damaging Het
Zfp990 T A 4: 145,536,927 V165D possibly damaging Het
Other mutations in Clptm1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01672:Clptm1l APN 13 73607873 splice site probably null
IGL01963:Clptm1l APN 13 73617569 splice site probably benign
IGL02169:Clptm1l APN 13 73611663 missense probably damaging 0.96
IGL02554:Clptm1l APN 13 73607760 missense probably benign 0.07
IGL02596:Clptm1l APN 13 73613666 missense probably benign 0.02
IGL02720:Clptm1l APN 13 73614602 splice site probably benign
IGL03100:Clptm1l APN 13 73612390 splice site probably benign
P0023:Clptm1l UTSW 13 73604952 missense possibly damaging 0.67
R0308:Clptm1l UTSW 13 73611667 missense possibly damaging 0.67
R0725:Clptm1l UTSW 13 73606343 missense probably benign
R1572:Clptm1l UTSW 13 73607747 missense probably benign
R1589:Clptm1l UTSW 13 73614673 critical splice donor site probably null
R2062:Clptm1l UTSW 13 73607723 nonsense probably null
R2064:Clptm1l UTSW 13 73607723 nonsense probably null
R2065:Clptm1l UTSW 13 73607723 nonsense probably null
R2067:Clptm1l UTSW 13 73607723 nonsense probably null
R2068:Clptm1l UTSW 13 73607723 nonsense probably null
R3003:Clptm1l UTSW 13 73617756 missense possibly damaging 0.51
R3712:Clptm1l UTSW 13 73616038 missense probably benign 0.21
R3808:Clptm1l UTSW 13 73612454 missense probably benign 0.13
R3966:Clptm1l UTSW 13 73615972 missense probably damaging 1.00
R4615:Clptm1l UTSW 13 73607738 nonsense probably null
R4801:Clptm1l UTSW 13 73607862 missense possibly damaging 0.81
R4802:Clptm1l UTSW 13 73607862 missense possibly damaging 0.81
R4957:Clptm1l UTSW 13 73611196 missense possibly damaging 0.52
R4957:Clptm1l UTSW 13 73612428 missense probably damaging 1.00
R5864:Clptm1l UTSW 13 73606284 missense probably damaging 0.99
R6502:Clptm1l UTSW 13 73617765 critical splice donor site probably null
R6701:Clptm1l UTSW 13 73608906 missense probably benign 0.00
R7782:Clptm1l UTSW 13 73604320 missense probably damaging 1.00
R8292:Clptm1l UTSW 13 73617735 missense probably damaging 0.96
R8329:Clptm1l UTSW 13 73612428 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATAGGTCCCACCCTATGCTGAG -3'
(R):5'- CTTGAGGACTATTGGCTGGACTC -3'

Sequencing Primer
(F):5'- GCTCACTGACTTGGGTTATAAAAC -3'
(R):5'- GGACTATTGGCTGGACTCTCAAAAC -3'
Posted On2018-08-01