Mutagenetix > Incidental Mutation

Incidental Mutation 'R6720:Clptm1l'

529556

Institutional Source

Beutler Lab

Gene Symbol

Clptm1l

Ensembl Gene

ENSMUSG00000021610

Gene Name

CLPTM1-like

Synonyms

C130052I12Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6720 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

73604006-73620605 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 73618516 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Arginine at position 512 (W512R)

Ref Sequence

ENSEMBL: ENSMUSP00000022102 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022102]

AlphaFold

Q8BXA5

Predicted Effect

probably damaging
Transcript: ENSMUST00000022102
AA Change: W512R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000022102
Gene: ENSMUSG00000021610
AA Change: W512R

Domain	Start	End	E-Value	Type
Pfam:CLPTM1	10	423	3.2e-134	PFAM
transmembrane domain	428	450	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221130

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221417

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222343

Meta Mutation Damage Score

0.8947

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.7%
20x: 93.6%

Validation Efficiency

98% (50/51)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane protein whose overexpression in cisplatin-sensitive cells causes apoptosis. Polymorphisms in this gene have been reported to increase susceptibility to several cancers, including lung, pancreatic, and breast cancers. [provided by RefSeq, Nov 2015]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700013G24Rik	G	A	4: 137,454,686	E51K	possibly damaging	Het
Abca1	A	C	4: 53,083,733	L700R	probably damaging	Het
Arpc1a	C	A	5: 145,101,222		probably null	Het
Baz2b	G	T	2: 59,924,890	P241Q	probably damaging	Het
Cd6	T	A	19: 10,794,609	T414S	probably benign	Het
Ces2b	A	T	8: 104,836,869	E409D	probably benign	Het
Cfap54	A	G	10: 92,821,119	Y3024H	probably benign	Het
Chrm1	A	G	19: 8,678,548	T206A	probably benign	Het
Col15a1	T	A	4: 47,247,552		probably null	Het
Cox15	A	G	19: 43,736,789	S392P	probably damaging	Het
Cr2	T	C	1: 195,155,200	M1197V	probably damaging	Het
Ddx60	A	G	8: 62,000,689	K1281E	probably benign	Het
Dnah11	A	G	12: 118,045,646	F2094L	probably damaging	Het
Ear2	T	A	14: 44,102,959	C25S	probably damaging	Het
Ect2l	T	C	10: 18,140,264	D802G	probably damaging	Het
Eftud2	G	A	11: 102,838,623	Q84*	probably null	Het
Eif4g3	T	A	4: 138,175,832		probably null	Het
Ephb2	T	C	4: 136,657,502	D866G	probably damaging	Het
Fam129b	T	A	2: 32,905,826	V22D	probably damaging	Het
Farsb	A	G	1: 78,472,497	M99T	probably damaging	Het
Foxs1	T	A	2: 152,932,720	S138C	probably damaging	Het
Frem1	T	G	4: 83,013,832	S211R	probably damaging	Het
Gm19410	G	A	8: 35,807,576	R1517Q	probably benign	Het
Gria2	T	C	3: 80,802,304	I27M	probably benign	Het
H2-Q7	A	G	17: 35,442,678	E299G	probably benign	Het
Hao2	T	G	3: 98,877,135	I305L	probably benign	Het
Hectd4	C	T	5: 121,307,381	Q122*	probably null	Het
Hivep1	T	A	13: 42,164,284	C2079S	probably damaging	Het
Hoxb1	C	A	11: 96,366,987	Q248K	probably damaging	Het
Hspb6	A	G	7: 30,554,347	D95G	probably benign	Het
Ighv5-2	T	A	12: 113,578,506	R117S	probably damaging	Het
Ino80d	A	C	1: 63,058,610	S708R	probably damaging	Het
Lman1l	A	G	9: 57,614,072		probably null	Het
Mmp15	A	G	8: 95,365,314	N51D	probably benign	Het
Naip1	T	C	13: 100,423,077	M1140V	probably benign	Het
Olfr1053	A	G	2: 86,315,065	S74P	probably damaging	Het
Olfr1373	A	G	11: 52,144,693	V279A	probably benign	Het
Olfr397	A	G	11: 73,965,465	N286D	probably damaging	Het
Olfr890	T	A	9: 38,143,153	M1K	probably null	Het
Pard3b	A	T	1: 62,159,470	N239I	probably damaging	Het
Parvb	C	T	15: 84,297,979	R237W	probably damaging	Het
Pcdha9	T	C	18: 36,998,069	S64P	probably damaging	Het
Pdcd1	T	C	1: 94,041,389	N68S	probably benign	Het
Pi4ka	G	T	16: 17,326,052		probably null	Het
Plekha4	A	T	7: 45,540,886	D359V	possibly damaging	Het
Serpinb13	A	G	1: 106,994,062	I78V	probably benign	Het
Slc39a7	T	A	17: 34,030,108	T269S	probably benign	Het
Sltm	T	G	9: 70,573,710	D281E	probably damaging	Het
Zfp708	T	C	13: 67,071,432	Y76C	probably damaging	Het
Zfp990	T	A	4: 145,536,927	V165D	possibly damaging	Het

Other mutations in Clptm1l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01672:Clptm1l	APN	13	73607873	splice site	probably null
IGL01963:Clptm1l	APN	13	73617569	splice site	probably benign
IGL02169:Clptm1l	APN	13	73611663	missense	probably damaging	0.96
IGL02554:Clptm1l	APN	13	73607760	missense	probably benign	0.07
IGL02596:Clptm1l	APN	13	73613666	missense	probably benign	0.02
IGL02720:Clptm1l	APN	13	73614602	splice site	probably benign
IGL03100:Clptm1l	APN	13	73612390	splice site	probably benign
P0023:Clptm1l	UTSW	13	73604952	missense	possibly damaging	0.67
R0308:Clptm1l	UTSW	13	73611667	missense	possibly damaging	0.67
R0725:Clptm1l	UTSW	13	73606343	missense	probably benign
R1572:Clptm1l	UTSW	13	73607747	missense	probably benign
R1589:Clptm1l	UTSW	13	73614673	critical splice donor site	probably null
R2062:Clptm1l	UTSW	13	73607723	nonsense	probably null
R2064:Clptm1l	UTSW	13	73607723	nonsense	probably null
R2065:Clptm1l	UTSW	13	73607723	nonsense	probably null
R2067:Clptm1l	UTSW	13	73607723	nonsense	probably null
R2068:Clptm1l	UTSW	13	73607723	nonsense	probably null
R3003:Clptm1l	UTSW	13	73617756	missense	possibly damaging	0.51
R3712:Clptm1l	UTSW	13	73616038	missense	probably benign	0.21
R3808:Clptm1l	UTSW	13	73612454	missense	probably benign	0.13
R3966:Clptm1l	UTSW	13	73615972	missense	probably damaging	1.00
R4615:Clptm1l	UTSW	13	73607738	nonsense	probably null
R4801:Clptm1l	UTSW	13	73607862	missense	possibly damaging	0.81
R4802:Clptm1l	UTSW	13	73607862	missense	possibly damaging	0.81
R4957:Clptm1l	UTSW	13	73611196	missense	possibly damaging	0.52
R4957:Clptm1l	UTSW	13	73612428	missense	probably damaging	1.00
R5864:Clptm1l	UTSW	13	73606284	missense	probably damaging	0.99
R6502:Clptm1l	UTSW	13	73617765	critical splice donor site	probably null
R6701:Clptm1l	UTSW	13	73608906	missense	probably benign	0.00
R7782:Clptm1l	UTSW	13	73604320	missense	probably damaging	1.00
R8292:Clptm1l	UTSW	13	73617735	missense	probably damaging	0.96
R8329:Clptm1l	UTSW	13	73612428	missense	probably damaging	1.00
R9224:Clptm1l	UTSW	13	73604225	start gained	probably benign
R9528:Clptm1l	UTSW	13	73612431	missense	possibly damaging	0.76

Predicted Primers

PCR Primer
(F):5'- TATAGGTCCCACCCTATGCTGAG -3'
(R):5'- CTTGAGGACTATTGGCTGGACTC -3'

Sequencing Primer
(F):5'- GCTCACTGACTTGGGTTATAAAAC -3'
(R):5'- GGACTATTGGCTGGACTCTCAAAAC -3'

Posted On

2018-08-01