Incidental Mutation 'R6720:Chrm1'
ID529564
Institutional Source Beutler Lab
Gene Symbol Chrm1
Ensembl Gene ENSMUSG00000032773
Gene Namecholinergic receptor, muscarinic 1, CNS
Synonymsmuscarinic acetylcholine receptor 1, M1R, M1, AW495047, Chrm-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock #R6720 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location8663789-8683587 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 8678548 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 206 (T206A)
Ref Sequence ENSEMBL: ENSMUSP00000126103 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035444] [ENSMUST00000163785] [ENSMUST00000177197]
Predicted Effect probably benign
Transcript: ENSMUST00000035444
AA Change: T206A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000042632
Gene: ENSMUSG00000032773
AA Change: T206A

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 36 227 1.7e-7 PFAM
Pfam:7tm_1 42 418 1.9e-97 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157205
Predicted Effect probably benign
Transcript: ENSMUST00000163785
AA Change: T206A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000126103
Gene: ENSMUSG00000032773
AA Change: T206A

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 36 227 1.7e-7 PFAM
Pfam:7tm_1 42 418 2.9e-83 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177197
SMART Domains Protein: ENSMUSP00000135356
Gene: ENSMUSG00000032773

DomainStartEndE-ValueType
Pfam:7tm_1 42 74 1.6e-9 PFAM
Meta Mutation Damage Score 0.0657 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.6%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The muscarinic cholinergic receptors belong to a larger family of G protein-coupled receptors. The functional diversity of these receptors is defined by the binding of acetylcholine and includes cellular responses such as adenylate cyclase inhibition, phosphoinositide degeneration, and potassium channel mediation. Muscarinic receptors influence many effects of acetylcholine in the central and peripheral nervous system. The muscarinic cholinergic receptor 1 is involved in mediation of vagally-induced bronchoconstriction and in the acid secretion of the gastrointestinal tract. The gene encoding this receptor is localized to 11q13. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit resistance to pilocarpine-induced seizures, selective memory deficits, elevated dopaminergic transmission in the striatum, and increased spontaneous and amphetamine-induced locomotion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik G A 4: 137,454,686 E51K possibly damaging Het
Abca1 A C 4: 53,083,733 L700R probably damaging Het
Arpc1a C A 5: 145,101,222 probably null Het
Baz2b G T 2: 59,924,890 P241Q probably damaging Het
Cd6 T A 19: 10,794,609 T414S probably benign Het
Ces2b A T 8: 104,836,869 E409D probably benign Het
Cfap54 A G 10: 92,821,119 Y3024H probably benign Het
Clptm1l T C 13: 73,618,516 W512R probably damaging Het
Col15a1 T A 4: 47,247,552 probably null Het
Cox15 A G 19: 43,736,789 S392P probably damaging Het
Cr2 T C 1: 195,155,200 M1197V probably damaging Het
Ddx60 A G 8: 62,000,689 K1281E probably benign Het
Dnah11 A G 12: 118,045,646 F2094L probably damaging Het
Ear2 T A 14: 44,102,959 C25S probably damaging Het
Ect2l T C 10: 18,140,264 D802G probably damaging Het
Eftud2 G A 11: 102,838,623 Q84* probably null Het
Eif4g3 T A 4: 138,175,832 probably null Het
Ephb2 T C 4: 136,657,502 D866G probably damaging Het
Fam129b T A 2: 32,905,826 V22D probably damaging Het
Farsb A G 1: 78,472,497 M99T probably damaging Het
Foxs1 T A 2: 152,932,720 S138C probably damaging Het
Frem1 T G 4: 83,013,832 S211R probably damaging Het
Gm19410 G A 8: 35,807,576 R1517Q probably benign Het
Gria2 T C 3: 80,802,304 I27M probably benign Het
H2-Q7 A G 17: 35,442,678 E299G probably benign Het
Hao2 T G 3: 98,877,135 I305L probably benign Het
Hectd4 C T 5: 121,307,381 Q122* probably null Het
Hivep1 T A 13: 42,164,284 C2079S probably damaging Het
Hoxb1 C A 11: 96,366,987 Q248K probably damaging Het
Hspb6 A G 7: 30,554,347 D95G probably benign Het
Ighv5-2 T A 12: 113,578,506 R117S probably damaging Het
Ino80d A C 1: 63,058,610 S708R probably damaging Het
Lman1l A G 9: 57,614,072 probably null Het
Mmp15 A G 8: 95,365,314 N51D probably benign Het
Naip1 T C 13: 100,423,077 M1140V probably benign Het
Olfr1053 A G 2: 86,315,065 S74P probably damaging Het
Olfr1373 A G 11: 52,144,693 V279A probably benign Het
Olfr397 A G 11: 73,965,465 N286D probably damaging Het
Olfr890 T A 9: 38,143,153 M1K probably null Het
Pard3b A T 1: 62,159,470 N239I probably damaging Het
Parvb C T 15: 84,297,979 R237W probably damaging Het
Pcdha9 T C 18: 36,998,069 S64P probably damaging Het
Pdcd1 T C 1: 94,041,389 N68S probably benign Het
Pi4ka G T 16: 17,326,052 probably null Het
Plekha4 A T 7: 45,540,886 D359V possibly damaging Het
Serpinb13 A G 1: 106,994,062 I78V probably benign Het
Slc39a7 T A 17: 34,030,108 T269S probably benign Het
Sltm T G 9: 70,573,710 D281E probably damaging Het
Zfp708 T C 13: 67,071,432 Y76C probably damaging Het
Zfp990 T A 4: 145,536,927 V165D possibly damaging Het
Other mutations in Chrm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00466:Chrm1 APN 19 8678074 missense probably benign 0.01
IGL01633:Chrm1 APN 19 8678495 missense probably benign 0.29
IGL01824:Chrm1 APN 19 8679130 missense probably damaging 0.98
IGL02539:Chrm1 APN 19 8678311 missense probably damaging 1.00
IGL03342:Chrm1 APN 19 8679308 missense probably benign 0.33
R1660:Chrm1 UTSW 19 8679218 missense possibly damaging 0.53
R1942:Chrm1 UTSW 19 8678273 missense probably damaging 0.99
R2208:Chrm1 UTSW 19 8678099 missense probably damaging 1.00
R6466:Chrm1 UTSW 19 8678178 nonsense probably null
R6535:Chrm1 UTSW 19 8679073 missense possibly damaging 0.93
R8061:Chrm1 UTSW 19 8679154 missense possibly damaging 0.93
R8262:Chrm1 UTSW 19 8679089 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CAGGGCAGCTCTGATGATTG -3'
(R):5'- GACTCCATGGAGCCTTCATC -3'

Sequencing Primer
(F):5'- CAGCTCTGATGATTGGCCTCG -3'
(R):5'- CTGTAGGCCTGCAGAAGTCTG -3'
Posted On2018-08-01