Incidental Mutation 'R6721:Taok3'
ID529581
Institutional Source Beutler Lab
Gene Symbol Taok3
Ensembl Gene ENSMUSG00000061288
Gene NameTAO kinase 3
SynonymsA430105I05Rik, 2900006A08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6721 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location117120129-117275219 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 117255863 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 567 (M567T)
Ref Sequence ENSEMBL: ENSMUSP00000136750 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092889] [ENSMUST00000111975] [ENSMUST00000111978] [ENSMUST00000145640] [ENSMUST00000179276]
Predicted Effect probably benign
Transcript: ENSMUST00000092889
AA Change: M567T

PolyPhen 2 Score 0.250 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000090565
Gene: ENSMUSG00000061288
AA Change: M567T

DomainStartEndE-ValueType
S_TKc 24 277 4.4e-84 SMART
low complexity region 321 337 N/A INTRINSIC
low complexity region 349 366 N/A INTRINSIC
coiled coil region 452 495 N/A INTRINSIC
low complexity region 520 532 N/A INTRINSIC
low complexity region 552 566 N/A INTRINSIC
coiled coil region 618 649 N/A INTRINSIC
coiled coil region 789 869 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111975
AA Change: M107T

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000107606
Gene: ENSMUSG00000061288
AA Change: M107T

DomainStartEndE-ValueType
coiled coil region 1 35 N/A INTRINSIC
low complexity region 60 72 N/A INTRINSIC
low complexity region 92 106 N/A INTRINSIC
coiled coil region 158 189 N/A INTRINSIC
coiled coil region 329 409 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111978
AA Change: M567T

PolyPhen 2 Score 0.250 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000107609
Gene: ENSMUSG00000061288
AA Change: M567T

DomainStartEndE-ValueType
S_TKc 24 277 4.4e-84 SMART
low complexity region 321 337 N/A INTRINSIC
low complexity region 349 366 N/A INTRINSIC
coiled coil region 452 495 N/A INTRINSIC
low complexity region 520 532 N/A INTRINSIC
low complexity region 552 566 N/A INTRINSIC
coiled coil region 618 649 N/A INTRINSIC
coiled coil region 789 869 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145640
SMART Domains Protein: ENSMUSP00000116920
Gene: ENSMUSG00000061288

DomainStartEndE-ValueType
S_TKc 24 277 2.2e-86 SMART
low complexity region 321 337 N/A INTRINSIC
low complexity region 349 366 N/A INTRINSIC
coiled coil region 452 495 N/A INTRINSIC
low complexity region 520 532 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000179276
AA Change: M567T

PolyPhen 2 Score 0.250 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000136750
Gene: ENSMUSG00000061288
AA Change: M567T

DomainStartEndE-ValueType
S_TKc 24 277 4.4e-84 SMART
low complexity region 321 337 N/A INTRINSIC
low complexity region 349 366 N/A INTRINSIC
coiled coil region 452 495 N/A INTRINSIC
low complexity region 520 532 N/A INTRINSIC
low complexity region 552 566 N/A INTRINSIC
coiled coil region 618 649 N/A INTRINSIC
coiled coil region 789 869 N/A INTRINSIC
Meta Mutation Damage Score 0.0932 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a serine/threonine protein kinase that activates the p38/MAPK14 stress-activated MAPK cascade but inhibits the basal activity of the MAPK8/JNK cascade. The encoded protein is a member of the GCK subfamily of STE20-like kinases. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610301B20Rik A G 4: 10,874,744 N44D probably benign Het
2610507B11Rik T C 11: 78,279,799 Y1615H probably damaging Het
Adgrv1 A G 13: 81,481,515 L3588S probably benign Het
Ankrd27 T C 7: 35,612,551 F402S probably damaging Het
Aplp1 T C 7: 30,440,295 Q359R probably null Het
Arhgef10l T C 4: 140,570,344 Y546C probably damaging Het
Cd46 T C 1: 195,083,631 Y142C probably damaging Het
Chd3 T C 11: 69,369,219 probably benign Het
Cmtm2b A G 8: 104,322,445 S31G possibly damaging Het
CN725425 A G 15: 91,231,618 K21R possibly damaging Het
Cngb1 T C 8: 95,270,888 T560A probably benign Het
Creb3l3 T C 10: 81,091,143 D151G probably damaging Het
Cts7 A T 13: 61,356,294 V124E probably damaging Het
Ctsd G A 7: 142,376,853 P349S possibly damaging Het
Ern1 A G 11: 106,411,652 W459R probably damaging Het
Faxc A T 4: 21,982,672 probably null Het
Gabbr1 T C 17: 37,054,192 I239T probably damaging Het
Galnt12 T A 4: 47,122,529 C269* probably null Het
Gmpr2 A T 14: 55,672,734 D7V probably damaging Het
Hivep3 T A 4: 120,095,099 I204N possibly damaging Het
Il16 A T 7: 83,663,062 probably null Het
Jag1 T C 2: 137,094,474 T367A probably benign Het
Lefty2 T C 1: 180,894,601 V168A probably damaging Het
Mecom T C 3: 29,979,874 E227G probably damaging Het
Muc5ac T A 7: 141,798,992 C739S possibly damaging Het
Npy1r T A 8: 66,704,289 C120* probably null Het
Nup153 A G 13: 46,701,026 V530A probably damaging Het
Ogfr T A 2: 180,595,428 L602Q possibly damaging Het
Olfr1564 C T 17: 33,215,534 G270E probably benign Het
Olfr18 A C 9: 20,314,280 D213E probably benign Het
Olfr978 C T 9: 39,994,307 P166S possibly damaging Het
Perm1 G T 4: 156,218,319 R440L probably benign Het
Plcb4 T C 2: 135,910,237 V121A probably benign Het
Plxna4 C T 6: 32,200,859 V1036M probably benign Het
Ppl A T 16: 5,107,469 M102K probably damaging Het
Prop1 T C 11: 50,953,386 S7G probably benign Het
Rabggta A G 14: 55,717,203 L507P probably damaging Het
Sfmbt2 A G 2: 10,543,025 T473A probably damaging Het
Spc25 A C 2: 69,197,173 M125R possibly damaging Het
Tlr3 A G 8: 45,398,880 Y327H probably benign Het
Tmem209 A G 6: 30,497,175 F339L probably benign Het
U2surp T C 9: 95,491,104 N279S probably damaging Het
Ythdf3 G A 3: 16,203,861 M61I possibly damaging Het
Zfp647 T C 15: 76,911,876 I195V probably benign Het
Other mutations in Taok3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01548:Taok3 APN 5 117272197 missense probably benign 0.20
IGL01632:Taok3 APN 5 117265928 missense possibly damaging 0.95
IGL02894:Taok3 APN 5 117263613 missense probably benign 0.19
bonze UTSW 5 117272229 nonsense probably null
daoist UTSW 5 117209571 missense probably damaging 0.99
haller UTSW 5 117206655 missense probably damaging 1.00
Perseveration UTSW 5 117255863 missense probably benign 0.25
taoist UTSW 5 117206655 missense probably damaging 1.00
Three_treasures UTSW 5 117217242 critical splice donor site probably null
PIT4366001:Taok3 UTSW 5 117227985 missense probably benign 0.21
R0046:Taok3 UTSW 5 117272229 nonsense probably null
R0046:Taok3 UTSW 5 117272229 nonsense probably null
R0158:Taok3 UTSW 5 117217242 critical splice donor site probably null
R0245:Taok3 UTSW 5 117252679 splice site probably benign
R0371:Taok3 UTSW 5 117206687 nonsense probably null
R1140:Taok3 UTSW 5 117228053 missense possibly damaging 0.94
R1302:Taok3 UTSW 5 117199043 missense possibly damaging 0.46
R1376:Taok3 UTSW 5 117265961 missense probably damaging 1.00
R1376:Taok3 UTSW 5 117265961 missense probably damaging 1.00
R1387:Taok3 UTSW 5 117206655 missense probably damaging 1.00
R1711:Taok3 UTSW 5 117255926 missense possibly damaging 0.68
R1977:Taok3 UTSW 5 117265924 missense probably damaging 0.98
R2898:Taok3 UTSW 5 117200069 critical splice acceptor site probably null
R3824:Taok3 UTSW 5 117255937 missense probably benign 0.01
R4378:Taok3 UTSW 5 117209571 missense probably damaging 0.99
R4695:Taok3 UTSW 5 117228066 missense probably benign 0.11
R4882:Taok3 UTSW 5 117252630 missense probably damaging 0.99
R5286:Taok3 UTSW 5 117266075 missense probably damaging 1.00
R5522:Taok3 UTSW 5 117273757 missense probably benign 0.00
R5562:Taok3 UTSW 5 117250964 missense probably damaging 1.00
R5643:Taok3 UTSW 5 117206720 missense probably benign
R6241:Taok3 UTSW 5 117272197 missense probably benign 0.33
R6290:Taok3 UTSW 5 117204368 missense probably damaging 1.00
R6310:Taok3 UTSW 5 117255938 missense possibly damaging 0.48
R6339:Taok3 UTSW 5 117228030 missense probably benign
R6717:Taok3 UTSW 5 117240950 intron probably benign
R6755:Taok3 UTSW 5 117206667 missense probably damaging 1.00
R7046:Taok3 UTSW 5 117273706 missense probably damaging 1.00
R7053:Taok3 UTSW 5 117252562 missense probably benign 0.00
R7259:Taok3 UTSW 5 117252543 missense probably benign 0.00
R7308:Taok3 UTSW 5 117200151 nonsense probably null
R7439:Taok3 UTSW 5 117250909 missense probably damaging 0.99
R7732:Taok3 UTSW 5 117193748 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- GATTTCTGGGGCTGAGAAGC -3'
(R):5'- GAATGTTCTGCTGTTCCACC -3'

Sequencing Primer
(F):5'- GAGGCAAACTCAAGCATCCC -3'
(R):5'- ACCTCGTGGCGCTTGATC -3'
Posted On2018-08-01