Incidental Mutation 'R6721:Creb3l3'
ID529596
Institutional Source Beutler Lab
Gene Symbol Creb3l3
Ensembl Gene ENSMUSG00000035041
Gene NamecAMP responsive element binding protein 3-like 3
SynonymsD10Bur1e, CREB-H
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6721 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location81084324-81098874 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 81091143 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 151 (D151G)
Ref Sequence ENSEMBL: ENSMUSP00000112836 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117422]
Predicted Effect probably damaging
Transcript: ENSMUST00000117422
AA Change: D151G

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000112836
Gene: ENSMUSG00000035041
AA Change: D151G

DomainStartEndE-ValueType
low complexity region 179 199 N/A INTRINSIC
BRLZ 237 301 4.36e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125907
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127374
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143969
Meta Mutation Damage Score 0.1668 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the basic-leucine zipper family and the AMP-dependent transcription factor family. The encoded protein is localized to the endoplasmic reticulum and acts as a transcription factor activated by cyclic AMP stimulation. The encoded protein binds the cyclic AMP response element (CRE) and the box-B element and has been linked to acute inflammatory response, hepatocellular carcinoma, triglyceride metabolism, and hepcidin expression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and healthy but exhibit reduced expression of acute phase response proteins following treatment with tunicamycin that induces ER stress. Mice homozygous for a different knock-out allele exhibit resistanceto sulpyrine-induced shock. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610301B20Rik A G 4: 10,874,744 N44D probably benign Het
2610507B11Rik T C 11: 78,279,799 Y1615H probably damaging Het
Adgrv1 A G 13: 81,481,515 L3588S probably benign Het
Ankrd27 T C 7: 35,612,551 F402S probably damaging Het
Aplp1 T C 7: 30,440,295 Q359R probably null Het
Arhgef10l T C 4: 140,570,344 Y546C probably damaging Het
Cd46 T C 1: 195,083,631 Y142C probably damaging Het
Chd3 T C 11: 69,369,219 probably benign Het
Cmtm2b A G 8: 104,322,445 S31G possibly damaging Het
CN725425 A G 15: 91,231,618 K21R possibly damaging Het
Cngb1 T C 8: 95,270,888 T560A probably benign Het
Cts7 A T 13: 61,356,294 V124E probably damaging Het
Ctsd G A 7: 142,376,853 P349S possibly damaging Het
Ern1 A G 11: 106,411,652 W459R probably damaging Het
Faxc A T 4: 21,982,672 probably null Het
Gabbr1 T C 17: 37,054,192 I239T probably damaging Het
Galnt12 T A 4: 47,122,529 C269* probably null Het
Gmpr2 A T 14: 55,672,734 D7V probably damaging Het
Hivep3 T A 4: 120,095,099 I204N possibly damaging Het
Il16 A T 7: 83,663,062 probably null Het
Jag1 T C 2: 137,094,474 T367A probably benign Het
Lefty2 T C 1: 180,894,601 V168A probably damaging Het
Mecom T C 3: 29,979,874 E227G probably damaging Het
Muc5ac T A 7: 141,798,992 C739S possibly damaging Het
Npy1r T A 8: 66,704,289 C120* probably null Het
Nup153 A G 13: 46,701,026 V530A probably damaging Het
Ogfr T A 2: 180,595,428 L602Q possibly damaging Het
Olfr1564 C T 17: 33,215,534 G270E probably benign Het
Olfr18 A C 9: 20,314,280 D213E probably benign Het
Olfr978 C T 9: 39,994,307 P166S possibly damaging Het
Perm1 G T 4: 156,218,319 R440L probably benign Het
Plcb4 T C 2: 135,910,237 V121A probably benign Het
Plxna4 C T 6: 32,200,859 V1036M probably benign Het
Ppl A T 16: 5,107,469 M102K probably damaging Het
Prop1 T C 11: 50,953,386 S7G probably benign Het
Rabggta A G 14: 55,717,203 L507P probably damaging Het
Sfmbt2 A G 2: 10,543,025 T473A probably damaging Het
Spc25 A C 2: 69,197,173 M125R possibly damaging Het
Taok3 T C 5: 117,255,863 M567T probably benign Het
Tlr3 A G 8: 45,398,880 Y327H probably benign Het
Tmem209 A G 6: 30,497,175 F339L probably benign Het
U2surp T C 9: 95,491,104 N279S probably damaging Het
Ythdf3 G A 3: 16,203,861 M61I possibly damaging Het
Zfp647 T C 15: 76,911,876 I195V probably benign Het
Other mutations in Creb3l3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01387:Creb3l3 APN 10 81091276 missense probably benign
IGL02651:Creb3l3 APN 10 81084834 missense probably benign 0.03
IGL03093:Creb3l3 APN 10 81091213 missense probably benign 0.00
PIT4382001:Creb3l3 UTSW 10 81084912 missense probably benign 0.01
R0501:Creb3l3 UTSW 10 81086582 missense probably benign 0.29
R2421:Creb3l3 UTSW 10 81091818 missense probably benign 0.01
R2567:Creb3l3 UTSW 10 81086049 missense probably benign 0.00
R4038:Creb3l3 UTSW 10 81089338 missense probably benign 0.15
R4748:Creb3l3 UTSW 10 81086047 missense probably benign 0.00
R5596:Creb3l3 UTSW 10 81085047 missense probably benign 0.01
R5814:Creb3l3 UTSW 10 81085662 missense probably benign 0.01
R5889:Creb3l3 UTSW 10 81092533 utr 5 prime probably benign
R6135:Creb3l3 UTSW 10 81085718 missense probably benign 0.20
R6299:Creb3l3 UTSW 10 81088613 missense probably damaging 1.00
R7472:Creb3l3 UTSW 10 81089467 intron probably null
R7761:Creb3l3 UTSW 10 81084999 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- ATTGAGCACCTACTGAGTTAGC -3'
(R):5'- ACAGTGACAGTGGCATCTCTG -3'

Sequencing Primer
(F):5'- ACCTACTGAGTTAGCCACAGTTG -3'
(R):5'- ACAGTGGCATCTCTGAGGATCTAC -3'
Posted On2018-08-01