Mutagenetix > Incidental Mutation

Incidental Mutation 'R6722:Atp1a4'

529615

Institutional Source

Beutler Lab

Gene Symbol

Atp1a4

Ensembl Gene

ENSMUSG00000007107

Gene Name

ATPase, Na+/K+ transporting, alpha 4 polypeptide

Synonyms

MMRRC Submission

044840-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6722 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

172223513-172258414 bp(-) (GRCm38)

Type of Mutation

unclassified

DNA Base Change (assembly)

T to C at 172258050 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000134280 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000111243] [ENSMUST00000139528]

AlphaFold

Q9WV27

Predicted Effect

probably benign
Transcript: ENSMUST00000111243

SMART Domains

Protein: ENSMUSP00000106874
Gene: ENSMUSG00000007107

Domain	Start	End	E-Value	Type
low complexity region	33	50	N/A	INTRINSIC
Cation_ATPase_N	51	125	1.22e-14	SMART
Pfam:E1-E2_ATPase	144	375	2.6e-59	PFAM
Pfam:Hydrolase	380	738	8.1e-19	PFAM
Pfam:HAD	383	735	1.6e-17	PFAM
Pfam:Cation_ATPase	437	531	9.2e-25	PFAM
Pfam:Cation_ATPase_C	808	1017	1.2e-47	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000139528

SMART Domains

Protein: ENSMUSP00000134280
Gene: ENSMUSG00000038034

Domain	Start	End	E-Value	Type
IG_like	19	84	3.66e1	SMART
low complexity region	92	103	N/A	INTRINSIC
IG	106	222	2.3e-3	SMART
IG	246	370	9.49e-5	SMART
IG	382	508	3.59e-5	SMART
transmembrane domain	515	537	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155363

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000193316

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 95.0%

Validation Efficiency

96% (52/54)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of Na+/K+ -ATPases. Na+/K+ -ATPase is an integral membrane protein responsible for establishing and maintaining the electrochemical gradients of Na and K ions across the plasma membrane. These gradients are essential for osmoregulation, for sodium-coupled transport of a variety of organic and inorganic molecules, and for electrical excitability of nerve and muscle. This enzyme is composed of two subunits, a large catalytic subunit (alpha) and a smaller glycoprotein subunit (beta). The catalytic subunit of Na+/K+ -ATPase is encoded by multiple genes. This gene encodes an alpha 4 subunit. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Male mice homozygous for a knock-out allele exhibit infertility associated with asthenozoospermia and teratozoospermia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam4	T	G	12: 81,421,454	D131A	probably damaging	Het
Ank3	T	C	10: 69,990,244		probably benign	Het
Arntl2	T	A	6: 146,818,900	D187E	probably damaging	Het
BC005561	T	A	5: 104,520,279	M889K	probably damaging	Het
Ccdc162	T	C	10: 41,644,641	N673S	probably benign	Het
Cd84	G	A	1: 171,872,777	V154M	probably damaging	Het
Celsr1	C	A	15: 85,905,914		probably null	Het
Cfap57	A	C	4: 118,584,717	L718R	probably damaging	Het
Cntnap5b	G	A	1: 100,478,486	V803M	probably damaging	Het
Col6a2	C	T	10: 76,614,558	V180I	probably damaging	Het
Coq4	A	T	2: 29,788,285		probably benign	Het
Cyp2a4	A	G	7: 26,313,558	T389A	probably benign	Het
Dennd1c	T	C	17: 57,066,802	D587G	probably benign	Het
Dnaja4	A	G	9: 54,699,754	D9G	probably damaging	Het
Gatsl2	T	C	5: 134,135,619	S140P	probably benign	Het
Gm11808	A	G	4: 3,973,386	Y59H	probably benign	Het
Hes2	T	G	4: 152,160,377	L101R	probably damaging	Het
Icam2	A	G	11: 106,382,481	S2P	probably damaging	Het
Krt31	A	G	11: 100,048,428	L221P	probably damaging	Het
Lipm	A	T	19: 34,121,265	N380Y	probably benign	Het
Lrp2bp	G	A	8: 46,020,563		probably null	Het
Mbd2	T	A	18: 70,580,748	M216K	probably damaging	Het
Mrps33	T	C	6: 39,805,665		probably benign	Het
Nbeal2	T	C	9: 110,632,992	D1459G	probably damaging	Het
Ncapd3	T	C	9: 27,087,556	S1281P	probably benign	Het
Nt5c1b	T	A	12: 10,372,874	Y56N	possibly damaging	Het
Nthl1	A	G	17: 24,634,034	K71E	probably benign	Het
Olfr1318	T	A	2: 112,156,882	N310K	probably benign	Het
Parvb	C	T	15: 84,297,979	R237W	probably damaging	Het
Pde4a	G	A	9: 21,211,225	A806T	probably damaging	Het
Pde4d	C	A	13: 109,632,898	S40*	probably null	Het
Pde4dip	G	A	3: 97,718,239	R1348*	probably null	Het
Pdx1	C	T	5: 147,270,500	P88S	probably damaging	Het
Pnisr	T	A	4: 21,859,165	V120D	probably damaging	Het
Prss51	G	T	14: 64,095,059	C65F	probably damaging	Het
Pus10	G	A	11: 23,702,975	E195K	possibly damaging	Het
Pzp	T	A	6: 128,487,954	Q1319L	probably damaging	Het
Rbpms	G	T	8: 33,834,393	T101K	probably damaging	Het
Rundc3a	A	G	11: 102,399,949	N281S	possibly damaging	Het
Scml4	C	T	10: 42,860,732		probably benign	Het
Sez6	T	C	11: 77,953,702	V117A	probably damaging	Het
Sgsm2	A	C	11: 74,865,424	C366W	probably damaging	Het
Slc12a4	T	C	8: 105,944,250		probably null	Het
Smg5	C	T	3: 88,353,025	R641C	probably damaging	Het
Stxbp3	A	G	3: 108,816,446	Y150H	probably benign	Het
Tkt	T	C	14: 30,569,084	F351S	probably damaging	Het
Tln1	A	G	4: 43,547,618	L781P	probably damaging	Het
Triobp	G	A	15: 79,001,565	E1823K	probably damaging	Het
Ttll4	T	C	1: 74,681,789	V538A	possibly damaging	Het
Vmn1r61	T	A	7: 5,610,688	N209I	possibly damaging	Het
Wdr75	T	A	1: 45,805,352		probably null	Het
Zfp985	T	C	4: 147,583,071	V132A	probably benign	Het
Zswim3	T	A	2: 164,820,624		probably null	Het

Other mutations in Atp1a4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00419:Atp1a4	APN	1	172239806	missense	probably damaging	1.00
IGL00924:Atp1a4	APN	1	172246772	missense	probably damaging	1.00
IGL01288:Atp1a4	APN	1	172257907	missense	possibly damaging	0.77
IGL01665:Atp1a4	APN	1	172246724	missense	probably benign
IGL02156:Atp1a4	APN	1	172257962	missense	probably benign
IGL02170:Atp1a4	APN	1	172234536	missense	possibly damaging	0.94
IGL02228:Atp1a4	APN	1	172254885	missense	possibly damaging	0.69
IGL02505:Atp1a4	APN	1	172235075	missense	probably damaging	1.00
IGL02653:Atp1a4	APN	1	172251406	missense	possibly damaging	0.81
IGL02792:Atp1a4	APN	1	172227299	critical splice donor site	probably null
IGL02794:Atp1a4	APN	1	172244086	missense	probably benign	0.13
IGL03102:Atp1a4	APN	1	172231151	missense	probably damaging	1.00
R0046:Atp1a4	UTSW	1	172240097	missense	probably benign	0.09
R0046:Atp1a4	UTSW	1	172240097	missense	probably benign	0.09
R0276:Atp1a4	UTSW	1	172257901	missense	probably damaging	1.00
R0309:Atp1a4	UTSW	1	172234987	missense	probably damaging	1.00
R0525:Atp1a4	UTSW	1	172239688	splice site	probably benign
R0615:Atp1a4	UTSW	1	172232060	splice site	probably benign
R0730:Atp1a4	UTSW	1	172240207	splice site	probably benign
R1412:Atp1a4	UTSW	1	172232009	missense	probably damaging	0.97
R1652:Atp1a4	UTSW	1	172254903	missense	probably damaging	1.00
R1898:Atp1a4	UTSW	1	172235048	missense	probably damaging	0.99
R1968:Atp1a4	UTSW	1	172240164	missense	probably benign
R2291:Atp1a4	UTSW	1	172244906	missense	probably damaging	1.00
R2897:Atp1a4	UTSW	1	172246690	missense	probably damaging	1.00
R2908:Atp1a4	UTSW	1	172234477	missense	probably benign
R3119:Atp1a4	UTSW	1	172239826	missense	probably damaging	0.99
R3731:Atp1a4	UTSW	1	172233961	missense	probably damaging	1.00
R4447:Atp1a4	UTSW	1	172234431	missense	probably damaging	0.99
R4602:Atp1a4	UTSW	1	172239765	missense	probably damaging	1.00
R4670:Atp1a4	UTSW	1	172235000	missense	probably benign	0.07
R4674:Atp1a4	UTSW	1	172257656	missense	possibly damaging	0.81
R4675:Atp1a4	UTSW	1	172257656	missense	possibly damaging	0.81
R4785:Atp1a4	UTSW	1	172254110	nonsense	probably null
R4958:Atp1a4	UTSW	1	172231151	missense	probably damaging	1.00
R5015:Atp1a4	UTSW	1	172254082	missense	probably damaging	1.00
R5149:Atp1a4	UTSW	1	172232005	missense	probably damaging	1.00
R5234:Atp1a4	UTSW	1	172227170	missense	possibly damaging	0.73
R5501:Atp1a4	UTSW	1	172246832	missense	probably damaging	1.00
R5682:Atp1a4	UTSW	1	172254163	missense	probably damaging	0.99
R5872:Atp1a4	UTSW	1	172244408	missense	probably damaging	1.00
R5933:Atp1a4	UTSW	1	172232274	missense	possibly damaging	0.91
R7087:Atp1a4	UTSW	1	172246702	missense	probably damaging	1.00
R7122:Atp1a4	UTSW	1	172231936	missense	possibly damaging	0.47
R7381:Atp1a4	UTSW	1	172240115	missense	possibly damaging	0.70
R7431:Atp1a4	UTSW	1	172250907	missense	probably benign	0.31
R8269:Atp1a4	UTSW	1	172232325	missense	probably damaging	1.00
R8400:Atp1a4	UTSW	1	172234494	missense	probably damaging	1.00
R8559:Atp1a4	UTSW	1	172251330	missense	probably damaging	1.00
R8680:Atp1a4	UTSW	1	172250999	missense	probably damaging	1.00
R8777:Atp1a4	UTSW	1	172232302	missense	probably damaging	1.00
R8777-TAIL:Atp1a4	UTSW	1	172232302	missense	probably damaging	1.00
R8867:Atp1a4	UTSW	1	172244924	missense	probably damaging	0.99
R8869:Atp1a4	UTSW	1	172227123	missense	probably benign
R9260:Atp1a4	UTSW	1	172246792	missense	probably damaging	1.00
R9300:Atp1a4	UTSW	1	172239831	missense	probably damaging	1.00
R9545:Atp1a4	UTSW	1	172250897	missense	probably benign	0.35
Z1176:Atp1a4	UTSW	1	172231954	missense	probably benign	0.44

Predicted Primers

PCR Primer
(F):5'- GGCAGTTTGCTTTGGCCATC -3'
(R):5'- AGCTTTACCACTCAGACTTGC -3'

Sequencing Primer
(F):5'- TTGGCCATCCTCACCATAAC -3'
(R):5'- TCCTTTCCTATGCTTATAGATAGCC -3'

Posted On

2018-08-01