Incidental Mutation 'R6722:Coq4'
ID529616
Institutional Source Beutler Lab
Gene Symbol Coq4
Ensembl Gene ENSMUSG00000026798
Gene Namecoenzyme Q4
SynonymsD2Ertd97e, EST-MNCb4625
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6722 (G1)
Quality Score125.008
Status Validated
Chromosome2
Chromosomal Location29787493-29797935 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to T at 29788285 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000135521 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028137] [ENSMUST00000048044] [ENSMUST00000113807] [ENSMUST00000143616] [ENSMUST00000148791] [ENSMUST00000156846] [ENSMUST00000176312] [ENSMUST00000176348] [ENSMUST00000177133] [ENSMUST00000177467]
Predicted Effect unknown
Transcript: ENSMUST00000028137
AA Change: M1L
SMART Domains Protein: ENSMUSP00000028137
Gene: ENSMUSG00000026798
AA Change: M1L

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
Pfam:Coq4 39 259 1.2e-98 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000048044
SMART Domains Protein: ENSMUSP00000041848
Gene: ENSMUSG00000039826

DomainStartEndE-ValueType
Pfam:TruB_N 84 233 1e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000113803
Predicted Effect probably benign
Transcript: ENSMUST00000113807
SMART Domains Protein: ENSMUSP00000109438
Gene: ENSMUSG00000039826

DomainStartEndE-ValueType
Pfam:TruB_N 84 180 5.7e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142694
Predicted Effect unknown
Transcript: ENSMUST00000143616
AA Change: M1L
SMART Domains Protein: ENSMUSP00000120160
Gene: ENSMUSG00000026798
AA Change: M1L

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
Pfam:Coq4 39 135 2e-33 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000148791
AA Change: M1L
SMART Domains Protein: ENSMUSP00000116944
Gene: ENSMUSG00000026798
AA Change: M1L

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
Pfam:Coq4 39 200 6.9e-75 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156846
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175644
Predicted Effect probably benign
Transcript: ENSMUST00000176312
Predicted Effect unknown
Transcript: ENSMUST00000176348
AA Change: M1L
SMART Domains Protein: ENSMUSP00000135687
Gene: ENSMUSG00000026798
AA Change: M1L

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
Pfam:Coq4 39 135 2e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177133
Predicted Effect probably benign
Transcript: ENSMUST00000177467
SMART Domains Protein: ENSMUSP00000135521
Gene: ENSMUSG00000039826

DomainStartEndE-ValueType
Pfam:TruB_N 84 187 3.2e-16 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency 96% (52/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the coenzyme Q biosynthesis pathway. Coenzyme Q, an essential component of the electron transport chain, shuttles electrons between complexes I or II to complex III of the mitochondrial transport chain. This protein appears to play a structural role in stabilizing a complex that contains most of the coenzyme Q biosynthesis enzymes. Mutations in this gene are associated with mitochondrial disorders linked to coenzyme Q deficiency. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam4 T G 12: 81,421,454 D131A probably damaging Het
Ank3 T C 10: 69,990,244 probably benign Het
Arntl2 T A 6: 146,818,900 D187E probably damaging Het
Atp1a4 T C 1: 172,258,050 probably benign Het
BC005561 T A 5: 104,520,279 M889K probably damaging Het
Ccdc162 T C 10: 41,644,641 N673S probably benign Het
Cd84 G A 1: 171,872,777 V154M probably damaging Het
Celsr1 C A 15: 85,905,914 probably null Het
Cfap57 A C 4: 118,584,717 L718R probably damaging Het
Cntnap5b G A 1: 100,478,486 V803M probably damaging Het
Col6a2 C T 10: 76,614,558 V180I probably damaging Het
Cyp2a4 A G 7: 26,313,558 T389A probably benign Het
Dennd1c T C 17: 57,066,802 D587G probably benign Het
Dnaja4 A G 9: 54,699,754 D9G probably damaging Het
Gatsl2 T C 5: 134,135,619 S140P probably benign Het
Gm11808 A G 4: 3,973,386 Y59H probably benign Het
Hes2 T G 4: 152,160,377 L101R probably damaging Het
Icam2 A G 11: 106,382,481 S2P probably damaging Het
Krt31 A G 11: 100,048,428 L221P probably damaging Het
Lipm A T 19: 34,121,265 N380Y probably benign Het
Lrp2bp G A 8: 46,020,563 probably null Het
Mbd2 T A 18: 70,580,748 M216K probably damaging Het
Mrps33 T C 6: 39,805,665 probably benign Het
Nbeal2 T C 9: 110,632,992 D1459G probably damaging Het
Ncapd3 T C 9: 27,087,556 S1281P probably benign Het
Nt5c1b T A 12: 10,372,874 Y56N possibly damaging Het
Nthl1 A G 17: 24,634,034 K71E probably benign Het
Olfr1318 T A 2: 112,156,882 N310K probably benign Het
Parvb C T 15: 84,297,979 R237W probably damaging Het
Pde4a G A 9: 21,211,225 A806T probably damaging Het
Pde4d C A 13: 109,632,898 S40* probably null Het
Pde4dip G A 3: 97,718,239 R1348* probably null Het
Pdx1 C T 5: 147,270,500 P88S probably damaging Het
Pnisr T A 4: 21,859,165 V120D probably damaging Het
Prss51 G T 14: 64,095,059 C65F probably damaging Het
Pus10 G A 11: 23,702,975 E195K possibly damaging Het
Pzp T A 6: 128,487,954 Q1319L probably damaging Het
Rbpms G T 8: 33,834,393 T101K probably damaging Het
Rundc3a A G 11: 102,399,949 N281S possibly damaging Het
Scml4 C T 10: 42,860,732 probably benign Het
Sez6 T C 11: 77,953,702 V117A probably damaging Het
Sgsm2 A C 11: 74,865,424 C366W probably damaging Het
Slc12a4 T C 8: 105,944,250 probably null Het
Smg5 C T 3: 88,353,025 R641C probably damaging Het
Stxbp3 A G 3: 108,816,446 Y150H probably benign Het
Tkt T C 14: 30,569,084 F351S probably damaging Het
Tln1 A G 4: 43,547,618 L781P probably damaging Het
Triobp G A 15: 79,001,565 E1823K probably damaging Het
Ttll4 T C 1: 74,681,789 V538A possibly damaging Het
Vmn1r61 T A 7: 5,610,688 N209I possibly damaging Het
Wdr75 T A 1: 45,805,352 probably null Het
Zfp985 T C 4: 147,583,071 V132A probably benign Het
Zswim3 T A 2: 164,820,624 probably null Het
Other mutations in Coq4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03229:Coq4 APN 2 29788485 missense probably benign 0.00
R0605:Coq4 UTSW 2 29789998 nonsense probably null
R1184:Coq4 UTSW 2 29788334 unclassified probably benign
R1917:Coq4 UTSW 2 29789926 missense probably damaging 1.00
R4844:Coq4 UTSW 2 29796014 missense possibly damaging 0.82
R5587:Coq4 UTSW 2 29795514 splice site probably null
R5635:Coq4 UTSW 2 29788355 missense possibly damaging 0.73
R5886:Coq4 UTSW 2 29790614 unclassified probably benign
R7548:Coq4 UTSW 2 29795408 missense possibly damaging 0.87
X0064:Coq4 UTSW 2 29789908 missense possibly damaging 0.95
Z1176:Coq4 UTSW 2 29795449 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- GTTGTTTTACTTCAGTGGCAAACAG -3'
(R):5'- GTTGTAGAGAGCCATTCCCG -3'

Sequencing Primer
(F):5'- CTTCAGTGGCAAACAGATCTTGTG -3'
(R):5'- ATGTGGTCCGGGTACAGCAG -3'
Posted On2018-08-01