Incidental Mutation 'R6722:Stxbp3'
ID529621
Institutional Source Beutler Lab
Gene Symbol Stxbp3
Ensembl Gene ENSMUSG00000027882
Gene Namesyntaxin binding protein 3
SynonymsStxbp3, Stxbp3a, Munc-18c
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6722 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location108793176-108840526 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 108816446 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 150 (Y150H)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102621]
Predicted Effect probably benign
Transcript: ENSMUST00000102621
AA Change: Y158H

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000099681
Gene: ENSMUSG00000027882
AA Change: Y158H

DomainStartEndE-ValueType
Pfam:Sec1 33 576 5.9e-107 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196679
AA Change: Y150H

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
Meta Mutation Damage Score 0.1052 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency 96% (52/54)
MGI Phenotype PHENOTYPE: Homozygous null mice display embryonic or perinatal lethality with reduced embryonic growth and malformation of the intermediate zone of the cerebral cortex. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam4 T G 12: 81,421,454 D131A probably damaging Het
Ank3 T C 10: 69,990,244 probably benign Het
Arntl2 T A 6: 146,818,900 D187E probably damaging Het
Atp1a4 T C 1: 172,258,050 probably benign Het
BC005561 T A 5: 104,520,279 M889K probably damaging Het
Ccdc162 T C 10: 41,644,641 N673S probably benign Het
Cd84 G A 1: 171,872,777 V154M probably damaging Het
Celsr1 C A 15: 85,905,914 probably null Het
Cfap57 A C 4: 118,584,717 L718R probably damaging Het
Cntnap5b G A 1: 100,478,486 V803M probably damaging Het
Col6a2 C T 10: 76,614,558 V180I probably damaging Het
Coq4 A T 2: 29,788,285 probably benign Het
Cyp2a4 A G 7: 26,313,558 T389A probably benign Het
Dennd1c T C 17: 57,066,802 D587G probably benign Het
Dnaja4 A G 9: 54,699,754 D9G probably damaging Het
Gatsl2 T C 5: 134,135,619 S140P probably benign Het
Gm11808 A G 4: 3,973,386 Y59H probably benign Het
Hes2 T G 4: 152,160,377 L101R probably damaging Het
Icam2 A G 11: 106,382,481 S2P probably damaging Het
Krt31 A G 11: 100,048,428 L221P probably damaging Het
Lipm A T 19: 34,121,265 N380Y probably benign Het
Lrp2bp G A 8: 46,020,563 probably null Het
Mbd2 T A 18: 70,580,748 M216K probably damaging Het
Mrps33 T C 6: 39,805,665 probably benign Het
Nbeal2 T C 9: 110,632,992 D1459G probably damaging Het
Ncapd3 T C 9: 27,087,556 S1281P probably benign Het
Nt5c1b T A 12: 10,372,874 Y56N possibly damaging Het
Nthl1 A G 17: 24,634,034 K71E probably benign Het
Olfr1318 T A 2: 112,156,882 N310K probably benign Het
Parvb C T 15: 84,297,979 R237W probably damaging Het
Pde4a G A 9: 21,211,225 A806T probably damaging Het
Pde4d C A 13: 109,632,898 S40* probably null Het
Pde4dip G A 3: 97,718,239 R1348* probably null Het
Pdx1 C T 5: 147,270,500 P88S probably damaging Het
Pnisr T A 4: 21,859,165 V120D probably damaging Het
Prss51 G T 14: 64,095,059 C65F probably damaging Het
Pus10 G A 11: 23,702,975 E195K possibly damaging Het
Pzp T A 6: 128,487,954 Q1319L probably damaging Het
Rbpms G T 8: 33,834,393 T101K probably damaging Het
Rundc3a A G 11: 102,399,949 N281S possibly damaging Het
Scml4 C T 10: 42,860,732 probably benign Het
Sez6 T C 11: 77,953,702 V117A probably damaging Het
Sgsm2 A C 11: 74,865,424 C366W probably damaging Het
Slc12a4 T C 8: 105,944,250 probably null Het
Smg5 C T 3: 88,353,025 R641C probably damaging Het
Tkt T C 14: 30,569,084 F351S probably damaging Het
Tln1 A G 4: 43,547,618 L781P probably damaging Het
Triobp G A 15: 79,001,565 E1823K probably damaging Het
Ttll4 T C 1: 74,681,789 V538A possibly damaging Het
Vmn1r61 T A 7: 5,610,688 N209I possibly damaging Het
Wdr75 T A 1: 45,805,352 probably null Het
Zfp985 T C 4: 147,583,071 V132A probably benign Het
Zswim3 T A 2: 164,820,624 probably null Het
Other mutations in Stxbp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00805:Stxbp3 APN 3 108816351 missense probably benign 0.05
IGL01370:Stxbp3 APN 3 108797425 nonsense probably null
IGL01810:Stxbp3 APN 3 108800152 missense probably benign 0.35
IGL02583:Stxbp3 APN 3 108800871 missense probably damaging 1.00
IGL02827:Stxbp3 APN 3 108809895 missense probably damaging 1.00
IGL03022:Stxbp3 APN 3 108800756 missense probably damaging 1.00
IGL03198:Stxbp3 APN 3 108827089 missense probably damaging 0.96
IGL03410:Stxbp3 APN 3 108802160 missense probably damaging 1.00
R0666:Stxbp3 UTSW 3 108805302 missense possibly damaging 0.49
R3887:Stxbp3 UTSW 3 108805233 splice site probably null
R4128:Stxbp3 UTSW 3 108794831 missense probably benign 0.03
R4683:Stxbp3 UTSW 3 108800872 missense probably damaging 1.00
R5106:Stxbp3 UTSW 3 108794927 missense probably benign 0.01
R5307:Stxbp3 UTSW 3 108793798 missense probably damaging 1.00
R6643:Stxbp3 UTSW 3 108793834 missense probably damaging 1.00
R6725:Stxbp3 UTSW 3 108827600 missense possibly damaging 0.47
R7110:Stxbp3 UTSW 3 108816333 missense probably damaging 1.00
R7135:Stxbp3 UTSW 3 108800755 missense probably damaging 1.00
R7231:Stxbp3 UTSW 3 108800809 missense probably damaging 1.00
R7769:Stxbp3 UTSW 3 108800828 missense probably benign
X0020:Stxbp3 UTSW 3 108793847 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTATGACCTGGAGCCTACACCTTAA -3'
(R):5'- GGGAGGCAGAGGAGAGATGA -3'

Sequencing Primer
(F):5'- TGCAGGGCATGGCAACTAC -3'
(R):5'- TGAAGGGAGTCAGGAGAGATCTG -3'
Posted On2018-08-01