Incidental Mutation 'R6722:Pnisr'
ID529623
Institutional Source Beutler Lab
Gene Symbol Pnisr
Ensembl Gene ENSMUSG00000028248
Gene NamePNN interacting serine/arginine-rich
SynonymsSfrs18, 5730406M06Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.952) question?
Stock #R6722 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location21847583-21876475 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 21859165 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 120 (V120D)
Ref Sequence ENSEMBL: ENSMUSP00000139324 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029911] [ENSMUST00000098238] [ENSMUST00000108229] [ENSMUST00000185001]
Predicted Effect probably damaging
Transcript: ENSMUST00000029911
AA Change: V120D

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000029911
Gene: ENSMUSG00000028248
AA Change: V120D

DomainStartEndE-ValueType
low complexity region 1 27 N/A INTRINSIC
internal_repeat_1 57 86 6.59e-5 PROSPERO
low complexity region 94 117 N/A INTRINSIC
internal_repeat_1 121 149 6.59e-5 PROSPERO
low complexity region 181 194 N/A INTRINSIC
Pfam:PNISR 223 391 1.1e-55 PFAM
low complexity region 429 449 N/A INTRINSIC
low complexity region 494 586 N/A INTRINSIC
low complexity region 592 640 N/A INTRINSIC
low complexity region 664 703 N/A INTRINSIC
low complexity region 746 783 N/A INTRINSIC
low complexity region 789 814 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000098238
AA Change: V120D

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000095840
Gene: ENSMUSG00000028248
AA Change: V120D

DomainStartEndE-ValueType
low complexity region 1 27 N/A INTRINSIC
internal_repeat_1 57 86 7.37e-5 PROSPERO
low complexity region 94 117 N/A INTRINSIC
internal_repeat_1 121 149 7.37e-5 PROSPERO
low complexity region 181 194 N/A INTRINSIC
coiled coil region 240 276 N/A INTRINSIC
low complexity region 289 298 N/A INTRINSIC
low complexity region 318 331 N/A INTRINSIC
low complexity region 334 347 N/A INTRINSIC
low complexity region 376 415 N/A INTRINSIC
low complexity region 429 449 N/A INTRINSIC
low complexity region 494 586 N/A INTRINSIC
low complexity region 592 640 N/A INTRINSIC
low complexity region 664 703 N/A INTRINSIC
low complexity region 746 783 N/A INTRINSIC
low complexity region 789 805 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108229
AA Change: V120D

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000103864
Gene: ENSMUSG00000028248
AA Change: V120D

DomainStartEndE-ValueType
low complexity region 1 27 N/A INTRINSIC
low complexity region 94 117 N/A INTRINSIC
low complexity region 181 194 N/A INTRINSIC
coiled coil region 240 276 N/A INTRINSIC
low complexity region 289 298 N/A INTRINSIC
low complexity region 318 331 N/A INTRINSIC
low complexity region 334 347 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138419
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138681
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150368
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150927
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151621
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152666
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156136
Predicted Effect probably damaging
Transcript: ENSMUST00000185001
AA Change: V120D

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000139324
Gene: ENSMUSG00000028248
AA Change: V120D

DomainStartEndE-ValueType
low complexity region 1 27 N/A INTRINSIC
low complexity region 94 117 N/A INTRINSIC
low complexity region 181 194 N/A INTRINSIC
coiled coil region 240 276 N/A INTRINSIC
low complexity region 289 298 N/A INTRINSIC
low complexity region 318 331 N/A INTRINSIC
low complexity region 334 347 N/A INTRINSIC
Meta Mutation Damage Score 0.0926 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency 96% (52/54)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam4 T G 12: 81,421,454 D131A probably damaging Het
Ank3 T C 10: 69,990,244 probably benign Het
Arntl2 T A 6: 146,818,900 D187E probably damaging Het
Atp1a4 T C 1: 172,258,050 probably benign Het
BC005561 T A 5: 104,520,279 M889K probably damaging Het
Ccdc162 T C 10: 41,644,641 N673S probably benign Het
Cd84 G A 1: 171,872,777 V154M probably damaging Het
Celsr1 C A 15: 85,905,914 probably null Het
Cfap57 A C 4: 118,584,717 L718R probably damaging Het
Cntnap5b G A 1: 100,478,486 V803M probably damaging Het
Col6a2 C T 10: 76,614,558 V180I probably damaging Het
Coq4 A T 2: 29,788,285 probably benign Het
Cyp2a4 A G 7: 26,313,558 T389A probably benign Het
Dennd1c T C 17: 57,066,802 D587G probably benign Het
Dnaja4 A G 9: 54,699,754 D9G probably damaging Het
Gatsl2 T C 5: 134,135,619 S140P probably benign Het
Gm11808 A G 4: 3,973,386 Y59H probably benign Het
Hes2 T G 4: 152,160,377 L101R probably damaging Het
Icam2 A G 11: 106,382,481 S2P probably damaging Het
Krt31 A G 11: 100,048,428 L221P probably damaging Het
Lipm A T 19: 34,121,265 N380Y probably benign Het
Lrp2bp G A 8: 46,020,563 probably null Het
Mbd2 T A 18: 70,580,748 M216K probably damaging Het
Mrps33 T C 6: 39,805,665 probably benign Het
Nbeal2 T C 9: 110,632,992 D1459G probably damaging Het
Ncapd3 T C 9: 27,087,556 S1281P probably benign Het
Nt5c1b T A 12: 10,372,874 Y56N possibly damaging Het
Nthl1 A G 17: 24,634,034 K71E probably benign Het
Olfr1318 T A 2: 112,156,882 N310K probably benign Het
Parvb C T 15: 84,297,979 R237W probably damaging Het
Pde4a G A 9: 21,211,225 A806T probably damaging Het
Pde4d C A 13: 109,632,898 S40* probably null Het
Pde4dip G A 3: 97,718,239 R1348* probably null Het
Pdx1 C T 5: 147,270,500 P88S probably damaging Het
Prss51 G T 14: 64,095,059 C65F probably damaging Het
Pus10 G A 11: 23,702,975 E195K possibly damaging Het
Pzp T A 6: 128,487,954 Q1319L probably damaging Het
Rbpms G T 8: 33,834,393 T101K probably damaging Het
Rundc3a A G 11: 102,399,949 N281S possibly damaging Het
Scml4 C T 10: 42,860,732 probably benign Het
Sez6 T C 11: 77,953,702 V117A probably damaging Het
Sgsm2 A C 11: 74,865,424 C366W probably damaging Het
Slc12a4 T C 8: 105,944,250 probably null Het
Smg5 C T 3: 88,353,025 R641C probably damaging Het
Stxbp3 A G 3: 108,816,446 Y150H probably benign Het
Tkt T C 14: 30,569,084 F351S probably damaging Het
Tln1 A G 4: 43,547,618 L781P probably damaging Het
Triobp G A 15: 79,001,565 E1823K probably damaging Het
Ttll4 T C 1: 74,681,789 V538A possibly damaging Het
Vmn1r61 T A 7: 5,610,688 N209I possibly damaging Het
Wdr75 T A 1: 45,805,352 probably null Het
Zfp985 T C 4: 147,583,071 V132A probably benign Het
Zswim3 T A 2: 164,820,624 probably null Het
Other mutations in Pnisr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:Pnisr APN 4 21870407 critical splice donor site probably null
IGL01467:Pnisr APN 4 21874650 unclassified probably benign
IGL01997:Pnisr APN 4 21871537 missense possibly damaging 0.95
IGL02641:Pnisr APN 4 21860908 missense probably benign 0.03
IGL02756:Pnisr APN 4 21862175 missense probably benign 0.07
R0106:Pnisr UTSW 4 21874617 unclassified probably benign
R0106:Pnisr UTSW 4 21874617 unclassified probably benign
R0620:Pnisr UTSW 4 21874092 unclassified probably benign
R0636:Pnisr UTSW 4 21873800 unclassified probably benign
R1179:Pnisr UTSW 4 21865937 missense possibly damaging 0.95
R1388:Pnisr UTSW 4 21862041 missense possibly damaging 0.88
R1450:Pnisr UTSW 4 21874912 critical splice acceptor site probably null
R1609:Pnisr UTSW 4 21871440 nonsense probably null
R1663:Pnisr UTSW 4 21873857 unclassified probably benign
R1670:Pnisr UTSW 4 21865893 missense probably damaging 1.00
R1721:Pnisr UTSW 4 21874086 unclassified probably benign
R1792:Pnisr UTSW 4 21860968 missense possibly damaging 0.94
R1867:Pnisr UTSW 4 21874086 unclassified probably benign
R1868:Pnisr UTSW 4 21874086 unclassified probably benign
R1909:Pnisr UTSW 4 21869517 missense possibly damaging 0.88
R1931:Pnisr UTSW 4 21873612 missense probably benign 0.01
R4843:Pnisr UTSW 4 21857400 intron probably benign
R4917:Pnisr UTSW 4 21859330 intron probably benign
R5076:Pnisr UTSW 4 21874990 unclassified probably benign
R5164:Pnisr UTSW 4 21859237 missense possibly damaging 0.88
R5227:Pnisr UTSW 4 21874587 unclassified probably benign
R7878:Pnisr UTSW 4 21874370 missense unknown
R7961:Pnisr UTSW 4 21874370 missense unknown
Z1088:Pnisr UTSW 4 21873684 missense probably benign
Z1176:Pnisr UTSW 4 21873684 missense probably benign
Z1177:Pnisr UTSW 4 21873684 missense probably benign
Predicted Primers PCR Primer
(F):5'- CATCCAAGAGTTGTTTTGGGAC -3'
(R):5'- GGCTATGTGCACATCTATGGAAG -3'

Sequencing Primer
(F):5'- TCACATGCCTGTAAGTGCAG -3'
(R):5'- GTGCACATCTATGGAAGTAAAGTAAC -3'
Posted On2018-08-01