Incidental Mutation 'R6722:BC005561'
ID529627
Institutional Source Beutler Lab
Gene Symbol BC005561
Ensembl Gene ENSMUSG00000079065
Gene NamecDNA sequence BC005561
Synonyms
MMRRC Submission
Accession Numbers

Genbank: NM_001166581; MGI: 3040669

Is this an essential gene? Probably essential (E-score: 0.938) question?
Stock #R6722 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location104508352-104522611 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 104520279 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 889 (M889K)
Ref Sequence ENSEMBL: ENSMUSP00000130629 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096452]
Predicted Effect probably damaging
Transcript: ENSMUST00000096452
AA Change: M889K

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000130629
Gene: ENSMUSG00000079065
AA Change: M889K

DomainStartEndE-ValueType
Pfam:THOC2_N 10 424 3.5e-65 PFAM
Pfam:THOC2_N 415 566 5.8e-32 PFAM
Pfam:Thoc2 568 643 8.3e-40 PFAM
low complexity region 729 747 N/A INTRINSIC
Pfam:Tho2 873 1173 1.1e-105 PFAM
low complexity region 1251 1262 N/A INTRINSIC
low complexity region 1266 1283 N/A INTRINSIC
coiled coil region 1310 1335 N/A INTRINSIC
low complexity region 1355 1366 N/A INTRINSIC
low complexity region 1459 1482 N/A INTRINSIC
low complexity region 1524 1543 N/A INTRINSIC
low complexity region 1561 1569 N/A INTRINSIC
Meta Mutation Damage Score 0.9605 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency 96% (52/54)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam4 T G 12: 81,421,454 D131A probably damaging Het
Ank3 T C 10: 69,990,244 probably benign Het
Arntl2 T A 6: 146,818,900 D187E probably damaging Het
Atp1a4 T C 1: 172,258,050 probably benign Het
Ccdc162 T C 10: 41,644,641 N673S probably benign Het
Cd84 G A 1: 171,872,777 V154M probably damaging Het
Celsr1 C A 15: 85,905,914 probably null Het
Cfap57 A C 4: 118,584,717 L718R probably damaging Het
Cntnap5b G A 1: 100,478,486 V803M probably damaging Het
Col6a2 C T 10: 76,614,558 V180I probably damaging Het
Coq4 A T 2: 29,788,285 probably benign Het
Cyp2a4 A G 7: 26,313,558 T389A probably benign Het
Dennd1c T C 17: 57,066,802 D587G probably benign Het
Dnaja4 A G 9: 54,699,754 D9G probably damaging Het
Gatsl2 T C 5: 134,135,619 S140P probably benign Het
Gm11808 A G 4: 3,973,386 Y59H probably benign Het
Hes2 T G 4: 152,160,377 L101R probably damaging Het
Icam2 A G 11: 106,382,481 S2P probably damaging Het
Krt31 A G 11: 100,048,428 L221P probably damaging Het
Lipm A T 19: 34,121,265 N380Y probably benign Het
Lrp2bp G A 8: 46,020,563 probably null Het
Mbd2 T A 18: 70,580,748 M216K probably damaging Het
Mrps33 T C 6: 39,805,665 probably benign Het
Nbeal2 T C 9: 110,632,992 D1459G probably damaging Het
Ncapd3 T C 9: 27,087,556 S1281P probably benign Het
Nt5c1b T A 12: 10,372,874 Y56N possibly damaging Het
Nthl1 A G 17: 24,634,034 K71E probably benign Het
Olfr1318 T A 2: 112,156,882 N310K probably benign Het
Parvb C T 15: 84,297,979 R237W probably damaging Het
Pde4a G A 9: 21,211,225 A806T probably damaging Het
Pde4d C A 13: 109,632,898 S40* probably null Het
Pde4dip G A 3: 97,718,239 R1348* probably null Het
Pdx1 C T 5: 147,270,500 P88S probably damaging Het
Pnisr T A 4: 21,859,165 V120D probably damaging Het
Prss51 G T 14: 64,095,059 C65F probably damaging Het
Pus10 G A 11: 23,702,975 E195K possibly damaging Het
Pzp T A 6: 128,487,954 Q1319L probably damaging Het
Rbpms G T 8: 33,834,393 T101K probably damaging Het
Rundc3a A G 11: 102,399,949 N281S possibly damaging Het
Scml4 C T 10: 42,860,732 probably benign Het
Sez6 T C 11: 77,953,702 V117A probably damaging Het
Sgsm2 A C 11: 74,865,424 C366W probably damaging Het
Slc12a4 T C 8: 105,944,250 probably null Het
Smg5 C T 3: 88,353,025 R641C probably damaging Het
Stxbp3 A G 3: 108,816,446 Y150H probably benign Het
Tkt T C 14: 30,569,084 F351S probably damaging Het
Tln1 A G 4: 43,547,618 L781P probably damaging Het
Triobp G A 15: 79,001,565 E1823K probably damaging Het
Ttll4 T C 1: 74,681,789 V538A possibly damaging Het
Vmn1r61 T A 7: 5,610,688 N209I possibly damaging Het
Wdr75 T A 1: 45,805,352 probably null Het
Zfp985 T C 4: 147,583,071 V132A probably benign Het
Zswim3 T A 2: 164,820,624 probably null Het
Other mutations in BC005561
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01023:BC005561 APN 5 104520500 missense probably damaging 1.00
IGL01024:BC005561 APN 5 104521746 missense probably benign 0.02
IGL01133:BC005561 APN 5 104517662 missense probably benign
IGL01564:BC005561 APN 5 104520663 missense probably benign 0.12
IGL01727:BC005561 APN 5 104519513 missense probably benign 0.01
IGL02086:BC005561 APN 5 104519001 missense possibly damaging 0.49
IGL02153:BC005561 APN 5 104521083 missense probably benign 0.02
IGL02256:BC005561 APN 5 104520283 nonsense probably null
IGL02436:BC005561 APN 5 104521155 missense probably benign 0.10
IGL02969:BC005561 APN 5 104519343 missense probably benign 0.01
IGL03275:BC005561 APN 5 104518277 missense probably benign 0.00
IGL03357:BC005561 APN 5 104520468 missense probably damaging 1.00
F2404:BC005561 UTSW 5 104520230 missense possibly damaging 0.83
R0318:BC005561 UTSW 5 104517753 missense probably benign 0.00
R0349:BC005561 UTSW 5 104519976 missense possibly damaging 0.85
R0454:BC005561 UTSW 5 104518211 missense probably benign 0.45
R0742:BC005561 UTSW 5 104522154 missense probably benign 0.00
R0842:BC005561 UTSW 5 104519200 missense possibly damaging 0.81
R0882:BC005561 UTSW 5 104519009 missense probably benign 0.05
R1123:BC005561 UTSW 5 104518470 missense probably damaging 1.00
R1171:BC005561 UTSW 5 104520903 missense possibly damaging 0.49
R1205:BC005561 UTSW 5 104520213 missense probably benign 0.28
R1261:BC005561 UTSW 5 104520635 missense probably damaging 0.98
R1432:BC005561 UTSW 5 104518104 missense probably damaging 1.00
R1447:BC005561 UTSW 5 104522204 missense possibly damaging 0.89
R1466:BC005561 UTSW 5 104518257 missense probably damaging 0.99
R1466:BC005561 UTSW 5 104518257 missense probably damaging 0.99
R1584:BC005561 UTSW 5 104518257 missense probably damaging 0.99
R1636:BC005561 UTSW 5 104520750 missense probably damaging 0.99
R1686:BC005561 UTSW 5 104519923 nonsense probably null
R1698:BC005561 UTSW 5 104520510 missense probably benign 0.09
R1816:BC005561 UTSW 5 104517834 missense probably benign 0.16
R1903:BC005561 UTSW 5 104518330 missense probably benign 0.00
R2096:BC005561 UTSW 5 104519969 missense possibly damaging 0.95
R2146:BC005561 UTSW 5 104518991 missense probably benign
R2226:BC005561 UTSW 5 104519420 missense probably damaging 1.00
R2227:BC005561 UTSW 5 104519420 missense probably damaging 1.00
R2383:BC005561 UTSW 5 104518988 missense probably benign 0.23
R2656:BC005561 UTSW 5 104519315 missense probably benign 0.05
R3982:BC005561 UTSW 5 104521023 missense probably benign 0.29
R3983:BC005561 UTSW 5 104521023 missense probably benign 0.29
R4115:BC005561 UTSW 5 104519433 missense probably damaging 1.00
R4345:BC005561 UTSW 5 104521449 missense probably benign 0.21
R4697:BC005561 UTSW 5 104522240 missense probably benign 0.00
R4711:BC005561 UTSW 5 104519661 missense probably damaging 0.98
R4742:BC005561 UTSW 5 104518857 missense probably benign 0.17
R4758:BC005561 UTSW 5 104520399 missense possibly damaging 0.48
R4863:BC005561 UTSW 5 104517750 missense possibly damaging 0.89
R4867:BC005561 UTSW 5 104521002 missense possibly damaging 0.91
R5024:BC005561 UTSW 5 104522258 missense possibly damaging 0.68
R5114:BC005561 UTSW 5 104519876 missense probably damaging 0.99
R5117:BC005561 UTSW 5 104520255 missense probably damaging 1.00
R5289:BC005561 UTSW 5 104519657 missense probably benign 0.03
R5341:BC005561 UTSW 5 104518076 missense probably damaging 1.00
R5420:BC005561 UTSW 5 104518359 missense probably damaging 0.99
R5421:BC005561 UTSW 5 104518395 missense probably benign 0.01
R5422:BC005561 UTSW 5 104519646 missense probably damaging 0.98
R5606:BC005561 UTSW 5 104521878 missense probably benign 0.00
R5939:BC005561 UTSW 5 104519207 missense possibly damaging 0.56
R6104:BC005561 UTSW 5 104518218 missense probably damaging 1.00
R6169:BC005561 UTSW 5 104518396 missense probably benign 0.00
R6316:BC005561 UTSW 5 104519729 missense probably damaging 1.00
R6352:BC005561 UTSW 5 104520198 missense probably benign 0.11
R6408:BC005561 UTSW 5 104518777 missense probably benign 0.19
R6458:BC005561 UTSW 5 104522303 missense probably benign 0.02
R6789:BC005561 UTSW 5 104517689 missense probably benign 0.00
R7214:BC005561 UTSW 5 104522363 missense probably benign
R7494:BC005561 UTSW 5 104518418 missense possibly damaging 0.90
R7733:BC005561 UTSW 5 104519960 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- CTCGGCCAATGTATGCACAC -3'
(R):5'- AACTCGCTGTACATGCTCC -3'

Sequencing Primer
(F):5'- GGCCAATGTATGCACACCATATTTC -3'
(R):5'- GCTGTACATGCTCCGTCTG -3'
Posted On2018-08-01