Incidental Mutation 'R6722:Pdx1'
ID529629
Institutional Source Beutler Lab
Gene Symbol Pdx1
Ensembl Gene ENSMUSG00000029644
Gene Namepancreatic and duodenal homeobox 1
SynonymsIDX-1, Ipf1, IPF-1, Mody4, pdx-1, STF-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6722 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location147269959-147275848 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 147270500 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 88 (P88S)
Ref Sequence ENSEMBL: ENSMUSP00000082729 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085591]
Predicted Effect probably damaging
Transcript: ENSMUST00000085591
AA Change: P88S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000082729
Gene: ENSMUSG00000029644
AA Change: P88S

DomainStartEndE-ValueType
low complexity region 78 109 N/A INTRINSIC
HOX 147 209 4.67e-27 SMART
low complexity region 211 225 N/A INTRINSIC
low complexity region 236 257 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172461
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174285
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201192
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency 96% (52/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transcriptional activator of several genes, including insulin, somatostatin, glucokinase, islet amyloid polypeptide, and glucose transporter type 2. The encoded nuclear protein is involved in the early development of the pancreas and plays a major role in glucose-dependent regulation of insulin gene expression. Defects in this gene are a cause of pancreatic agenesis, which can lead to early-onset insulin-dependent diabetes mellitus (NIDDM), as well as maturity onset diabetes of the young type 4 (MODY4). [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit postnatal lethality, abnormal pancreatic and liver development, and increased plasma glucose levels. Mice heterozygous for a knock-out allele exhibit abnormal pancreatic development and abnormal glucose homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam4 T G 12: 81,421,454 D131A probably damaging Het
Ank3 T C 10: 69,990,244 probably benign Het
Arntl2 T A 6: 146,818,900 D187E probably damaging Het
Atp1a4 T C 1: 172,258,050 probably benign Het
BC005561 T A 5: 104,520,279 M889K probably damaging Het
Ccdc162 T C 10: 41,644,641 N673S probably benign Het
Cd84 G A 1: 171,872,777 V154M probably damaging Het
Celsr1 C A 15: 85,905,914 probably null Het
Cfap57 A C 4: 118,584,717 L718R probably damaging Het
Cntnap5b G A 1: 100,478,486 V803M probably damaging Het
Col6a2 C T 10: 76,614,558 V180I probably damaging Het
Coq4 A T 2: 29,788,285 probably benign Het
Cyp2a4 A G 7: 26,313,558 T389A probably benign Het
Dennd1c T C 17: 57,066,802 D587G probably benign Het
Dnaja4 A G 9: 54,699,754 D9G probably damaging Het
Gatsl2 T C 5: 134,135,619 S140P probably benign Het
Gm11808 A G 4: 3,973,386 Y59H probably benign Het
Hes2 T G 4: 152,160,377 L101R probably damaging Het
Icam2 A G 11: 106,382,481 S2P probably damaging Het
Krt31 A G 11: 100,048,428 L221P probably damaging Het
Lipm A T 19: 34,121,265 N380Y probably benign Het
Lrp2bp G A 8: 46,020,563 probably null Het
Mbd2 T A 18: 70,580,748 M216K probably damaging Het
Mrps33 T C 6: 39,805,665 probably benign Het
Nbeal2 T C 9: 110,632,992 D1459G probably damaging Het
Ncapd3 T C 9: 27,087,556 S1281P probably benign Het
Nt5c1b T A 12: 10,372,874 Y56N possibly damaging Het
Nthl1 A G 17: 24,634,034 K71E probably benign Het
Olfr1318 T A 2: 112,156,882 N310K probably benign Het
Parvb C T 15: 84,297,979 R237W probably damaging Het
Pde4a G A 9: 21,211,225 A806T probably damaging Het
Pde4d C A 13: 109,632,898 S40* probably null Het
Pde4dip G A 3: 97,718,239 R1348* probably null Het
Pnisr T A 4: 21,859,165 V120D probably damaging Het
Prss51 G T 14: 64,095,059 C65F probably damaging Het
Pus10 G A 11: 23,702,975 E195K possibly damaging Het
Pzp T A 6: 128,487,954 Q1319L probably damaging Het
Rbpms G T 8: 33,834,393 T101K probably damaging Het
Rundc3a A G 11: 102,399,949 N281S possibly damaging Het
Scml4 C T 10: 42,860,732 probably benign Het
Sez6 T C 11: 77,953,702 V117A probably damaging Het
Sgsm2 A C 11: 74,865,424 C366W probably damaging Het
Slc12a4 T C 8: 105,944,250 probably null Het
Smg5 C T 3: 88,353,025 R641C probably damaging Het
Stxbp3 A G 3: 108,816,446 Y150H probably benign Het
Tkt T C 14: 30,569,084 F351S probably damaging Het
Tln1 A G 4: 43,547,618 L781P probably damaging Het
Triobp G A 15: 79,001,565 E1823K probably damaging Het
Ttll4 T C 1: 74,681,789 V538A possibly damaging Het
Vmn1r61 T A 7: 5,610,688 N209I possibly damaging Het
Wdr75 T A 1: 45,805,352 probably null Het
Zfp985 T C 4: 147,583,071 V132A probably benign Het
Zswim3 T A 2: 164,820,624 probably null Het
Other mutations in Pdx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01724:Pdx1 APN 5 147274407 missense probably damaging 0.99
IGL02729:Pdx1 APN 5 147274614 missense probably benign 0.21
R6500:Pdx1 UTSW 5 147270630 missense probably damaging 0.99
R6811:Pdx1 UTSW 5 147274664 missense possibly damaging 0.83
R8253:Pdx1 UTSW 5 147270649 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGCCAGAGTTCAGCGCTAAC -3'
(R):5'- ACTTGTGAGAAAAGGCCCGG -3'

Sequencing Primer
(F):5'- CAGTTTACAAGCTCGCTG -3'
(R):5'- TTCTTGAAGGCAGTAGCAGC -3'
Posted On2018-08-01