Incidental Mutation 'R6722:Rbpms'
ID529635
Institutional Source Beutler Lab
Gene Symbol Rbpms
Ensembl Gene ENSMUSG00000031586
Gene NameRNA binding protein gene with multiple splicing
Synonymshermes, 2700019M19Rik, 2010300K22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.689) question?
Stock #R6722 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location33782643-33929863 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 33834393 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 101 (T101K)
Ref Sequence ENSEMBL: ENSMUSP00000138420 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033994] [ENSMUST00000033995] [ENSMUST00000053251] [ENSMUST00000182256] [ENSMUST00000182987] [ENSMUST00000183062] [ENSMUST00000183088] [ENSMUST00000191473]
Predicted Effect probably damaging
Transcript: ENSMUST00000033994
AA Change: T103K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000033994
Gene: ENSMUSG00000031586
AA Change: T103K

DomainStartEndE-ValueType
RRM 25 97 7.84e-8 SMART
low complexity region 149 172 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000033995
AA Change: T103K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000033995
Gene: ENSMUSG00000031586
AA Change: T103K

DomainStartEndE-ValueType
RRM 25 97 7.84e-8 SMART
low complexity region 149 172 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000053251
AA Change: T103K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000055813
Gene: ENSMUSG00000031586
AA Change: T103K

DomainStartEndE-ValueType
RRM 25 97 7.84e-8 SMART
low complexity region 149 172 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181120
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182184
Predicted Effect probably benign
Transcript: ENSMUST00000182256
SMART Domains Protein: ENSMUSP00000138140
Gene: ENSMUSG00000031586

DomainStartEndE-ValueType
low complexity region 45 68 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000182987
AA Change: T103K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000138483
Gene: ENSMUSG00000031586
AA Change: T103K

DomainStartEndE-ValueType
RRM 25 97 7.84e-8 SMART
low complexity region 149 172 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183062
SMART Domains Protein: ENSMUSP00000138726
Gene: ENSMUSG00000031586

DomainStartEndE-ValueType
low complexity region 45 63 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000183088
AA Change: T101K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138420
Gene: ENSMUSG00000031586
AA Change: T101K

DomainStartEndE-ValueType
RRM 23 95 7.84e-8 SMART
low complexity region 147 159 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000191473
AA Change: T103K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140387
Gene: ENSMUSG00000031586
AA Change: T103K

DomainStartEndE-ValueType
RRM 25 97 7.84e-8 SMART
low complexity region 149 172 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231786
Meta Mutation Damage Score 0.2857 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency 96% (52/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the RNA recognition motif family of RNA-binding proteins. The RNA recognition motif is between 80-100 amino acids in length and family members contain one to four copies of the motif. The RNA recognition motif consists of two short stretches of conserved sequence, as well as a few highly conserved hydrophobic residues. The encoded protein has a single, putative RNA recognition motif in its N-terminus. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jun 2013]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam4 T G 12: 81,421,454 D131A probably damaging Het
Ank3 T C 10: 69,990,244 probably benign Het
Arntl2 T A 6: 146,818,900 D187E probably damaging Het
Atp1a4 T C 1: 172,258,050 probably benign Het
BC005561 T A 5: 104,520,279 M889K probably damaging Het
Ccdc162 T C 10: 41,644,641 N673S probably benign Het
Cd84 G A 1: 171,872,777 V154M probably damaging Het
Celsr1 C A 15: 85,905,914 probably null Het
Cfap57 A C 4: 118,584,717 L718R probably damaging Het
Cntnap5b G A 1: 100,478,486 V803M probably damaging Het
Col6a2 C T 10: 76,614,558 V180I probably damaging Het
Coq4 A T 2: 29,788,285 probably benign Het
Cyp2a4 A G 7: 26,313,558 T389A probably benign Het
Dennd1c T C 17: 57,066,802 D587G probably benign Het
Dnaja4 A G 9: 54,699,754 D9G probably damaging Het
Gatsl2 T C 5: 134,135,619 S140P probably benign Het
Gm11808 A G 4: 3,973,386 Y59H probably benign Het
Hes2 T G 4: 152,160,377 L101R probably damaging Het
Icam2 A G 11: 106,382,481 S2P probably damaging Het
Krt31 A G 11: 100,048,428 L221P probably damaging Het
Lipm A T 19: 34,121,265 N380Y probably benign Het
Lrp2bp G A 8: 46,020,563 probably null Het
Mbd2 T A 18: 70,580,748 M216K probably damaging Het
Mrps33 T C 6: 39,805,665 probably benign Het
Nbeal2 T C 9: 110,632,992 D1459G probably damaging Het
Ncapd3 T C 9: 27,087,556 S1281P probably benign Het
Nt5c1b T A 12: 10,372,874 Y56N possibly damaging Het
Nthl1 A G 17: 24,634,034 K71E probably benign Het
Olfr1318 T A 2: 112,156,882 N310K probably benign Het
Parvb C T 15: 84,297,979 R237W probably damaging Het
Pde4a G A 9: 21,211,225 A806T probably damaging Het
Pde4d C A 13: 109,632,898 S40* probably null Het
Pde4dip G A 3: 97,718,239 R1348* probably null Het
Pdx1 C T 5: 147,270,500 P88S probably damaging Het
Pnisr T A 4: 21,859,165 V120D probably damaging Het
Prss51 G T 14: 64,095,059 C65F probably damaging Het
Pus10 G A 11: 23,702,975 E195K possibly damaging Het
Pzp T A 6: 128,487,954 Q1319L probably damaging Het
Rundc3a A G 11: 102,399,949 N281S possibly damaging Het
Scml4 C T 10: 42,860,732 probably benign Het
Sez6 T C 11: 77,953,702 V117A probably damaging Het
Sgsm2 A C 11: 74,865,424 C366W probably damaging Het
Slc12a4 T C 8: 105,944,250 probably null Het
Smg5 C T 3: 88,353,025 R641C probably damaging Het
Stxbp3 A G 3: 108,816,446 Y150H probably benign Het
Tkt T C 14: 30,569,084 F351S probably damaging Het
Tln1 A G 4: 43,547,618 L781P probably damaging Het
Triobp G A 15: 79,001,565 E1823K probably damaging Het
Ttll4 T C 1: 74,681,789 V538A possibly damaging Het
Vmn1r61 T A 7: 5,610,688 N209I possibly damaging Het
Wdr75 T A 1: 45,805,352 probably null Het
Zfp985 T C 4: 147,583,071 V132A probably benign Het
Zswim3 T A 2: 164,820,624 probably null Het
Other mutations in Rbpms
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4354001:Rbpms UTSW 8 33806838 missense possibly damaging 0.61
R0637:Rbpms UTSW 8 33806836 missense probably damaging 1.00
R1183:Rbpms UTSW 8 33804072 missense possibly damaging 0.83
R2850:Rbpms UTSW 8 33834377 missense possibly damaging 0.94
R7576:Rbpms UTSW 8 33866388 missense probably damaging 1.00
R7689:Rbpms UTSW 8 33864359 missense possibly damaging 0.58
R7699:Rbpms UTSW 8 33864363 missense probably damaging 1.00
R7763:Rbpms UTSW 8 33789453 missense probably benign
R7909:Rbpms UTSW 8 33864359 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCCATTTCTTCACCAACATG -3'
(R):5'- TAAATGCTGAGGCTGAGAGC -3'

Sequencing Primer
(F):5'- TTTCTTCACCAACATGGAAAACAAG -3'
(R):5'- TGAGAGCCCTTGCCAACC -3'
Posted On2018-08-01