Incidental Mutation 'R6722:Slc12a4'
ID529637
Institutional Source Beutler Lab
Gene Symbol Slc12a4
Ensembl Gene ENSMUSG00000017765
Gene Namesolute carrier family 12, member 4
SynonymsKCC1, K-Cl Co-transporter-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.316) question?
Stock #R6722 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location105943590-105966097 bp(-) (GRCm38)
Type of Mutationsplice site (25 bp from exon)
DNA Base Change (assembly) T to C at 105944250 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000112130 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034370] [ENSMUST00000038896] [ENSMUST00000116429]
Predicted Effect probably null
Transcript: ENSMUST00000034370
SMART Domains Protein: ENSMUSP00000034370
Gene: ENSMUSG00000017765

DomainStartEndE-ValueType
low complexity region 97 117 N/A INTRINSIC
Pfam:AA_permease 125 318 5.8e-28 PFAM
Pfam:AA_permease 409 698 1.2e-40 PFAM
Pfam:SLC12 710 833 7.1e-18 PFAM
Pfam:SLC12 829 1087 4.8e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000038896
SMART Domains Protein: ENSMUSP00000038232
Gene: ENSMUSG00000035237

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:LCAT 81 414 1.7e-111 PFAM
low complexity region 425 437 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000116429
SMART Domains Protein: ENSMUSP00000112130
Gene: ENSMUSG00000017765

DomainStartEndE-ValueType
low complexity region 95 115 N/A INTRINSIC
Pfam:AA_permease 123 309 7.7e-29 PFAM
Pfam:AA_permease_2 390 654 2.9e-17 PFAM
Pfam:AA_permease 404 696 4.4e-39 PFAM
Pfam:KCl_Cotrans_1 953 982 9.2e-21 PFAM
low complexity region 1065 1080 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141168
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141326
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency 96% (52/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SLC12A transporter family. The encoded protein mediates the coupled movement of potassium and chloride ions across the plasma membrane. This gene is expressed ubiquitously. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a constitutively active mutation display microcytosis and hypochromic anemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam4 T G 12: 81,421,454 D131A probably damaging Het
Ank3 T C 10: 69,990,244 probably benign Het
Arntl2 T A 6: 146,818,900 D187E probably damaging Het
Atp1a4 T C 1: 172,258,050 probably benign Het
BC005561 T A 5: 104,520,279 M889K probably damaging Het
Ccdc162 T C 10: 41,644,641 N673S probably benign Het
Cd84 G A 1: 171,872,777 V154M probably damaging Het
Celsr1 C A 15: 85,905,914 probably null Het
Cfap57 A C 4: 118,584,717 L718R probably damaging Het
Cntnap5b G A 1: 100,478,486 V803M probably damaging Het
Col6a2 C T 10: 76,614,558 V180I probably damaging Het
Coq4 A T 2: 29,788,285 probably benign Het
Cyp2a4 A G 7: 26,313,558 T389A probably benign Het
Dennd1c T C 17: 57,066,802 D587G probably benign Het
Dnaja4 A G 9: 54,699,754 D9G probably damaging Het
Gatsl2 T C 5: 134,135,619 S140P probably benign Het
Gm11808 A G 4: 3,973,386 Y59H probably benign Het
Hes2 T G 4: 152,160,377 L101R probably damaging Het
Icam2 A G 11: 106,382,481 S2P probably damaging Het
Krt31 A G 11: 100,048,428 L221P probably damaging Het
Lipm A T 19: 34,121,265 N380Y probably benign Het
Lrp2bp G A 8: 46,020,563 probably null Het
Mbd2 T A 18: 70,580,748 M216K probably damaging Het
Mrps33 T C 6: 39,805,665 probably benign Het
Nbeal2 T C 9: 110,632,992 D1459G probably damaging Het
Ncapd3 T C 9: 27,087,556 S1281P probably benign Het
Nt5c1b T A 12: 10,372,874 Y56N possibly damaging Het
Nthl1 A G 17: 24,634,034 K71E probably benign Het
Olfr1318 T A 2: 112,156,882 N310K probably benign Het
Parvb C T 15: 84,297,979 R237W probably damaging Het
Pde4a G A 9: 21,211,225 A806T probably damaging Het
Pde4d C A 13: 109,632,898 S40* probably null Het
Pde4dip G A 3: 97,718,239 R1348* probably null Het
Pdx1 C T 5: 147,270,500 P88S probably damaging Het
Pnisr T A 4: 21,859,165 V120D probably damaging Het
Prss51 G T 14: 64,095,059 C65F probably damaging Het
Pus10 G A 11: 23,702,975 E195K possibly damaging Het
Pzp T A 6: 128,487,954 Q1319L probably damaging Het
Rbpms G T 8: 33,834,393 T101K probably damaging Het
Rundc3a A G 11: 102,399,949 N281S possibly damaging Het
Scml4 C T 10: 42,860,732 probably benign Het
Sez6 T C 11: 77,953,702 V117A probably damaging Het
Sgsm2 A C 11: 74,865,424 C366W probably damaging Het
Smg5 C T 3: 88,353,025 R641C probably damaging Het
Stxbp3 A G 3: 108,816,446 Y150H probably benign Het
Tkt T C 14: 30,569,084 F351S probably damaging Het
Tln1 A G 4: 43,547,618 L781P probably damaging Het
Triobp G A 15: 79,001,565 E1823K probably damaging Het
Ttll4 T C 1: 74,681,789 V538A possibly damaging Het
Vmn1r61 T A 7: 5,610,688 N209I possibly damaging Het
Wdr75 T A 1: 45,805,352 probably null Het
Zfp985 T C 4: 147,583,071 V132A probably benign Het
Zswim3 T A 2: 164,820,624 probably null Het
Other mutations in Slc12a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01471:Slc12a4 APN 8 105944089 missense probably damaging 1.00
IGL01637:Slc12a4 APN 8 105960707 missense possibly damaging 0.72
IGL01736:Slc12a4 APN 8 105945843 critical splice donor site probably null
IGL01804:Slc12a4 APN 8 105944401 missense probably damaging 1.00
IGL02000:Slc12a4 APN 8 105945232 missense probably damaging 1.00
IGL02526:Slc12a4 APN 8 105949806 missense possibly damaging 0.90
IGL03371:Slc12a4 APN 8 105950505 missense probably null 0.99
IGL03385:Slc12a4 APN 8 105950864 unclassified probably benign
PIT4810001:Slc12a4 UTSW 8 105951596 missense probably benign 0.00
R0033:Slc12a4 UTSW 8 105947479 splice site probably benign
R0200:Slc12a4 UTSW 8 105951617 missense probably benign 0.09
R0201:Slc12a4 UTSW 8 105945350 missense possibly damaging 0.79
R0270:Slc12a4 UTSW 8 105945389 missense probably benign 0.10
R0389:Slc12a4 UTSW 8 105951967 missense probably benign 0.00
R0432:Slc12a4 UTSW 8 105959488 missense probably damaging 1.00
R0751:Slc12a4 UTSW 8 105951900 missense probably damaging 1.00
R1717:Slc12a4 UTSW 8 105947571 splice site probably null
R1792:Slc12a4 UTSW 8 105951843 missense possibly damaging 0.91
R1940:Slc12a4 UTSW 8 105946037 missense probably benign 0.29
R3115:Slc12a4 UTSW 8 105959459 missense probably damaging 1.00
R4898:Slc12a4 UTSW 8 105944609 missense probably damaging 1.00
R5182:Slc12a4 UTSW 8 105944606 missense probably damaging 1.00
R5220:Slc12a4 UTSW 8 105953852 missense probably damaging 1.00
R5283:Slc12a4 UTSW 8 105950694 critical splice donor site probably null
R5367:Slc12a4 UTSW 8 105951634 missense probably damaging 0.99
R5610:Slc12a4 UTSW 8 105950213 missense possibly damaging 0.87
R5921:Slc12a4 UTSW 8 105945244 critical splice acceptor site probably null
R6060:Slc12a4 UTSW 8 105945706 missense probably damaging 1.00
R6182:Slc12a4 UTSW 8 105947899 missense probably damaging 1.00
R6800:Slc12a4 UTSW 8 105949739 missense probably damaging 1.00
R6956:Slc12a4 UTSW 8 105953852 missense probably damaging 1.00
R7032:Slc12a4 UTSW 8 105949233 missense probably damaging 1.00
R7092:Slc12a4 UTSW 8 105945223 missense probably damaging 1.00
R7229:Slc12a4 UTSW 8 105946737 missense probably benign 0.05
R7243:Slc12a4 UTSW 8 105953920 missense probably damaging 1.00
R7323:Slc12a4 UTSW 8 105955715 missense probably damaging 1.00
R7325:Slc12a4 UTSW 8 105955715 missense probably damaging 1.00
R7327:Slc12a4 UTSW 8 105955715 missense probably damaging 1.00
R7426:Slc12a4 UTSW 8 105950836 missense probably benign 0.00
R7569:Slc12a4 UTSW 8 105945847 missense probably damaging 1.00
R7710:Slc12a4 UTSW 8 105945571 missense possibly damaging 0.95
R7968:Slc12a4 UTSW 8 105951605 missense possibly damaging 0.94
R7970:Slc12a4 UTSW 8 105951605 missense possibly damaging 0.94
R7971:Slc12a4 UTSW 8 105951605 missense possibly damaging 0.94
R7972:Slc12a4 UTSW 8 105951605 missense possibly damaging 0.94
R7973:Slc12a4 UTSW 8 105951605 missense possibly damaging 0.94
R8221:Slc12a4 UTSW 8 105951969 missense probably benign 0.00
R8386:Slc12a4 UTSW 8 105951618 missense probably damaging 1.00
R8393:Slc12a4 UTSW 8 105951819 missense probably damaging 0.99
X0019:Slc12a4 UTSW 8 105944352 missense probably damaging 0.98
Z1177:Slc12a4 UTSW 8 105946732 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- GCACTGTTGTCCTAGACACC -3'
(R):5'- ACAAAGATCGCTGGCCTGTG -3'

Sequencing Primer
(F):5'- AAGACTCCATCGGGGCTCAG -3'
(R):5'- TGTGACCAGCCACTTGGTCTG -3'
Posted On2018-08-01