Incidental Mutation 'R6722:Col6a2'
ID529645
Institutional Source Beutler Lab
Gene Symbol Col6a2
Ensembl Gene ENSMUSG00000020241
Gene Namecollagen, type VI, alpha 2
SynonymsCol6a-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6722 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location76595762-76623630 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 76614558 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 180 (V180I)
Ref Sequence ENSEMBL: ENSMUSP00000001181 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001181] [ENSMUST00000105413]
Predicted Effect probably damaging
Transcript: ENSMUST00000001181
AA Change: V180I

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000001181
Gene: ENSMUSG00000020241
AA Change: V180I

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
VWA 59 246 9.55e-29 SMART
Pfam:Collagen 269 329 3.3e-11 PFAM
Pfam:Collagen 317 383 6.2e-10 PFAM
Pfam:Collagen 366 430 2.2e-8 PFAM
Pfam:Collagen 424 483 1.7e-9 PFAM
low complexity region 502 517 N/A INTRINSIC
Pfam:Collagen 546 605 1.1e-9 PFAM
VWA 628 816 7.51e-36 SMART
VWA 846 1029 3.97e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105413
AA Change: V180I

PolyPhen 2 Score 0.118 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000101053
Gene: ENSMUSG00000020241
AA Change: V180I

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
VWA 59 246 9.55e-29 SMART
Pfam:Collagen 269 330 5.2e-12 PFAM
Pfam:Collagen 316 384 6.1e-10 PFAM
Pfam:Collagen 364 431 1.4e-8 PFAM
Pfam:Collagen 424 483 5.3e-10 PFAM
Pfam:Collagen 475 542 3.3e-9 PFAM
Pfam:Collagen 531 605 7.4e-8 PFAM
VWA 628 816 7.51e-36 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137365
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency 96% (52/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the three alpha chains of type VI collagen, a beaded filament collagen found in most connective tissues. The product of this gene contains several domains similar to von Willebrand Factor type A domains. These domains have been shown to bind extracellular matrix proteins, an interaction that explains the importance of this collagen in organizing matrix components. Mutations in this gene are associated with Bethlem myopathy and Ullrich scleroatonic muscular dystrophy. Three transcript variants have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit reduced body weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam4 T G 12: 81,421,454 D131A probably damaging Het
Ank3 T C 10: 69,990,244 probably benign Het
Arntl2 T A 6: 146,818,900 D187E probably damaging Het
Atp1a4 T C 1: 172,258,050 probably benign Het
BC005561 T A 5: 104,520,279 M889K probably damaging Het
Ccdc162 T C 10: 41,644,641 N673S probably benign Het
Cd84 G A 1: 171,872,777 V154M probably damaging Het
Celsr1 C A 15: 85,905,914 probably null Het
Cfap57 A C 4: 118,584,717 L718R probably damaging Het
Cntnap5b G A 1: 100,478,486 V803M probably damaging Het
Coq4 A T 2: 29,788,285 probably benign Het
Cyp2a4 A G 7: 26,313,558 T389A probably benign Het
Dennd1c T C 17: 57,066,802 D587G probably benign Het
Dnaja4 A G 9: 54,699,754 D9G probably damaging Het
Gatsl2 T C 5: 134,135,619 S140P probably benign Het
Gm11808 A G 4: 3,973,386 Y59H probably benign Het
Hes2 T G 4: 152,160,377 L101R probably damaging Het
Icam2 A G 11: 106,382,481 S2P probably damaging Het
Krt31 A G 11: 100,048,428 L221P probably damaging Het
Lipm A T 19: 34,121,265 N380Y probably benign Het
Lrp2bp G A 8: 46,020,563 probably null Het
Mbd2 T A 18: 70,580,748 M216K probably damaging Het
Mrps33 T C 6: 39,805,665 probably benign Het
Nbeal2 T C 9: 110,632,992 D1459G probably damaging Het
Ncapd3 T C 9: 27,087,556 S1281P probably benign Het
Nt5c1b T A 12: 10,372,874 Y56N possibly damaging Het
Nthl1 A G 17: 24,634,034 K71E probably benign Het
Olfr1318 T A 2: 112,156,882 N310K probably benign Het
Parvb C T 15: 84,297,979 R237W probably damaging Het
Pde4a G A 9: 21,211,225 A806T probably damaging Het
Pde4d C A 13: 109,632,898 S40* probably null Het
Pde4dip G A 3: 97,718,239 R1348* probably null Het
Pdx1 C T 5: 147,270,500 P88S probably damaging Het
Pnisr T A 4: 21,859,165 V120D probably damaging Het
Prss51 G T 14: 64,095,059 C65F probably damaging Het
Pus10 G A 11: 23,702,975 E195K possibly damaging Het
Pzp T A 6: 128,487,954 Q1319L probably damaging Het
Rbpms G T 8: 33,834,393 T101K probably damaging Het
Rundc3a A G 11: 102,399,949 N281S possibly damaging Het
Scml4 C T 10: 42,860,732 probably benign Het
Sez6 T C 11: 77,953,702 V117A probably damaging Het
Sgsm2 A C 11: 74,865,424 C366W probably damaging Het
Slc12a4 T C 8: 105,944,250 probably null Het
Smg5 C T 3: 88,353,025 R641C probably damaging Het
Stxbp3 A G 3: 108,816,446 Y150H probably benign Het
Tkt T C 14: 30,569,084 F351S probably damaging Het
Tln1 A G 4: 43,547,618 L781P probably damaging Het
Triobp G A 15: 79,001,565 E1823K probably damaging Het
Ttll4 T C 1: 74,681,789 V538A possibly damaging Het
Vmn1r61 T A 7: 5,610,688 N209I possibly damaging Het
Wdr75 T A 1: 45,805,352 probably null Het
Zfp985 T C 4: 147,583,071 V132A probably benign Het
Zswim3 T A 2: 164,820,624 probably null Het
Other mutations in Col6a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00959:Col6a2 APN 10 76614534 missense probably damaging 0.96
IGL01995:Col6a2 APN 10 76604842 splice site probably benign
IGL02005:Col6a2 APN 10 76610173 missense probably damaging 1.00
IGL02793:Col6a2 APN 10 76596310 missense possibly damaging 0.96
IGL03144:Col6a2 APN 10 76614425 missense probably benign
piddling UTSW 10 76608106 critical splice donor site probably null
R0137:Col6a2 UTSW 10 76596425 missense probably damaging 1.00
R0371:Col6a2 UTSW 10 76614473 missense probably benign 0.25
R0423:Col6a2 UTSW 10 76614917 missense possibly damaging 0.85
R0554:Col6a2 UTSW 10 76611161 critical splice donor site probably null
R0781:Col6a2 UTSW 10 76607740 missense probably benign 0.00
R0831:Col6a2 UTSW 10 76604105 missense probably damaging 1.00
R1110:Col6a2 UTSW 10 76607740 missense probably benign 0.00
R1499:Col6a2 UTSW 10 76603710 missense probably damaging 1.00
R1502:Col6a2 UTSW 10 76614678 missense probably benign 0.00
R1854:Col6a2 UTSW 10 76614812 missense probably damaging 0.98
R1878:Col6a2 UTSW 10 76614788 missense probably benign 0.00
R3410:Col6a2 UTSW 10 76603359 missense probably benign 0.17
R4110:Col6a2 UTSW 10 76606169 splice site probably null
R4242:Col6a2 UTSW 10 76608106 critical splice donor site probably null
R5562:Col6a2 UTSW 10 76599675 nonsense probably null
R5603:Col6a2 UTSW 10 76596769 missense probably damaging 1.00
R5641:Col6a2 UTSW 10 76613278 missense probably damaging 1.00
R5681:Col6a2 UTSW 10 76609251 splice site probably null
R5707:Col6a2 UTSW 10 76611031 missense possibly damaging 0.95
R5735:Col6a2 UTSW 10 76599893 missense probably benign 0.32
R5789:Col6a2 UTSW 10 76604389 missense probably damaging 1.00
R6134:Col6a2 UTSW 10 76607144 missense probably damaging 0.97
R6156:Col6a2 UTSW 10 76604170 missense possibly damaging 0.92
R6208:Col6a2 UTSW 10 76615057 missense possibly damaging 0.88
R6296:Col6a2 UTSW 10 76611049 missense probably damaging 1.00
R6328:Col6a2 UTSW 10 76614378 missense possibly damaging 0.67
R6329:Col6a2 UTSW 10 76599828 missense probably benign 0.01
R7012:Col6a2 UTSW 10 76614677 missense possibly damaging 0.95
R7091:Col6a2 UTSW 10 76615091 missense unknown
R7422:Col6a2 UTSW 10 76603336 nonsense probably null
R7655:Col6a2 UTSW 10 76607756 missense probably benign 0.00
R7656:Col6a2 UTSW 10 76607756 missense probably benign 0.00
R7802:Col6a2 UTSW 10 76603798 missense probably damaging 1.00
R7986:Col6a2 UTSW 10 76615138 missense probably benign
R8156:Col6a2 UTSW 10 76596791 missense possibly damaging 0.91
R8233:Col6a2 UTSW 10 76608706 critical splice donor site probably null
RF020:Col6a2 UTSW 10 76606209 critical splice acceptor site probably null
Z1177:Col6a2 UTSW 10 76596350 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- ATGGTGTCCTGGTCAATCTCG -3'
(R):5'- TGGTCTACACTTCTCGGACC -3'

Sequencing Primer
(F):5'- CCTGGTCAATCTCGGTAGAGTC -3'
(R):5'- ACTTCTCGGACCAAGTGGAG -3'
Posted On2018-08-01