Incidental Mutation 'R6722:Rundc3a'
ID529650
Institutional Source Beutler Lab
Gene Symbol Rundc3a
Ensembl Gene ENSMUSG00000006575
Gene NameRUN domain containing 3A
SynonymsRpip8, Rap2ip
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R6722 (G1)
Quality Score107.008
Status Validated
Chromosome11
Chromosomal Location102393403-102402555 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 102399949 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 281 (N281S)
Ref Sequence ENSEMBL: ENSMUSP00000102720 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006750] [ENSMUST00000018821] [ENSMUST00000107098] [ENSMUST00000107102] [ENSMUST00000107103] [ENSMUST00000107105] [ENSMUST00000124755] [ENSMUST00000130436] [ENSMUST00000134669] [ENSMUST00000154001] [ENSMUST00000142097] [ENSMUST00000155104] [ENSMUST00000149777]
Predicted Effect possibly damaging
Transcript: ENSMUST00000006750
AA Change: N286S

PolyPhen 2 Score 0.466 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000006750
Gene: ENSMUSG00000006575
AA Change: N286S

DomainStartEndE-ValueType
RUN 125 187 2.34e-19 SMART
coiled coil region 267 322 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000018821
SMART Domains Protein: ENSMUSP00000018821
Gene: ENSMUSG00000018677

DomainStartEndE-ValueType
Pfam:Mito_carr 7 156 6.9e-23 PFAM
Pfam:Mito_carr 158 247 6.1e-19 PFAM
Pfam:Mito_carr 251 352 1.1e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107098
SMART Domains Protein: ENSMUSP00000102715
Gene: ENSMUSG00000018677

DomainStartEndE-ValueType
Pfam:Mito_carr 7 148 1.4e-21 PFAM
Pfam:Mito_carr 150 240 3.7e-19 PFAM
Pfam:Mito_carr 243 344 4.6e-21 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000107102
AA Change: N286S

PolyPhen 2 Score 0.466 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000102719
Gene: ENSMUSG00000006575
AA Change: N286S

DomainStartEndE-ValueType
RUN 125 187 2.34e-19 SMART
coiled coil region 267 322 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000107103
AA Change: N281S

PolyPhen 2 Score 0.728 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000102720
Gene: ENSMUSG00000006575
AA Change: N281S

DomainStartEndE-ValueType
RUN 120 182 2.34e-19 SMART
coiled coil region 262 317 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000107105
AA Change: N286S

PolyPhen 2 Score 0.466 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000102722
Gene: ENSMUSG00000006575
AA Change: N286S

DomainStartEndE-ValueType
RUN 125 187 2.34e-19 SMART
coiled coil region 267 320 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123688
Predicted Effect probably benign
Transcript: ENSMUST00000124755
SMART Domains Protein: ENSMUSP00000120021
Gene: ENSMUSG00000018677

DomainStartEndE-ValueType
Pfam:Mito_carr 7 71 1.3e-9 PFAM
Pfam:Mito_carr 92 152 9.7e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128331
Predicted Effect probably benign
Transcript: ENSMUST00000128825
SMART Domains Protein: ENSMUSP00000121790
Gene: ENSMUSG00000018677

DomainStartEndE-ValueType
Pfam:Mito_carr 35 77 6.5e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130436
SMART Domains Protein: ENSMUSP00000115087
Gene: ENSMUSG00000018677

DomainStartEndE-ValueType
Pfam:Mito_carr 7 70 1.8e-9 PFAM
Pfam:Mito_carr 92 156 5.7e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131219
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183859
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142157
Predicted Effect probably benign
Transcript: ENSMUST00000134669
SMART Domains Protein: ENSMUSP00000114481
Gene: ENSMUSG00000018677

DomainStartEndE-ValueType
Pfam:Mito_carr 7 69 1.9e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154001
SMART Domains Protein: ENSMUSP00000116336
Gene: ENSMUSG00000018677

DomainStartEndE-ValueType
Pfam:Mito_carr 7 70 3.1e-10 PFAM
Pfam:Mito_carr 92 156 9.8e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142097
SMART Domains Protein: ENSMUSP00000114365
Gene: ENSMUSG00000018677

DomainStartEndE-ValueType
Pfam:Mito_carr 7 63 2e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153395
Predicted Effect probably benign
Transcript: ENSMUST00000155104
SMART Domains Protein: ENSMUSP00000115445
Gene: ENSMUSG00000018677

DomainStartEndE-ValueType
Pfam:Mito_carr 7 69 3.7e-9 PFAM
Pfam:Mito_carr 92 156 1.2e-14 PFAM
Pfam:Mito_carr 158 248 5.4e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150982
Predicted Effect probably benign
Transcript: ENSMUST00000149777
SMART Domains Protein: ENSMUSP00000115365
Gene: ENSMUSG00000018677

DomainStartEndE-ValueType
Pfam:Mito_carr 7 70 2.7e-9 PFAM
Pfam:Mito_carr 92 156 8.7e-15 PFAM
Pfam:Mito_carr 158 220 6.5e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132876
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146330
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141535
Meta Mutation Damage Score 0.0713 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency 96% (52/54)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam4 T G 12: 81,421,454 D131A probably damaging Het
Ank3 T C 10: 69,990,244 probably benign Het
Arntl2 T A 6: 146,818,900 D187E probably damaging Het
Atp1a4 T C 1: 172,258,050 probably benign Het
BC005561 T A 5: 104,520,279 M889K probably damaging Het
Ccdc162 T C 10: 41,644,641 N673S probably benign Het
Cd84 G A 1: 171,872,777 V154M probably damaging Het
Celsr1 C A 15: 85,905,914 probably null Het
Cfap57 A C 4: 118,584,717 L718R probably damaging Het
Cntnap5b G A 1: 100,478,486 V803M probably damaging Het
Col6a2 C T 10: 76,614,558 V180I probably damaging Het
Coq4 A T 2: 29,788,285 probably benign Het
Cyp2a4 A G 7: 26,313,558 T389A probably benign Het
Dennd1c T C 17: 57,066,802 D587G probably benign Het
Dnaja4 A G 9: 54,699,754 D9G probably damaging Het
Gatsl2 T C 5: 134,135,619 S140P probably benign Het
Gm11808 A G 4: 3,973,386 Y59H probably benign Het
Hes2 T G 4: 152,160,377 L101R probably damaging Het
Icam2 A G 11: 106,382,481 S2P probably damaging Het
Krt31 A G 11: 100,048,428 L221P probably damaging Het
Lipm A T 19: 34,121,265 N380Y probably benign Het
Lrp2bp G A 8: 46,020,563 probably null Het
Mbd2 T A 18: 70,580,748 M216K probably damaging Het
Mrps33 T C 6: 39,805,665 probably benign Het
Nbeal2 T C 9: 110,632,992 D1459G probably damaging Het
Ncapd3 T C 9: 27,087,556 S1281P probably benign Het
Nt5c1b T A 12: 10,372,874 Y56N possibly damaging Het
Nthl1 A G 17: 24,634,034 K71E probably benign Het
Olfr1318 T A 2: 112,156,882 N310K probably benign Het
Parvb C T 15: 84,297,979 R237W probably damaging Het
Pde4a G A 9: 21,211,225 A806T probably damaging Het
Pde4d C A 13: 109,632,898 S40* probably null Het
Pde4dip G A 3: 97,718,239 R1348* probably null Het
Pdx1 C T 5: 147,270,500 P88S probably damaging Het
Pnisr T A 4: 21,859,165 V120D probably damaging Het
Prss51 G T 14: 64,095,059 C65F probably damaging Het
Pus10 G A 11: 23,702,975 E195K possibly damaging Het
Pzp T A 6: 128,487,954 Q1319L probably damaging Het
Rbpms G T 8: 33,834,393 T101K probably damaging Het
Scml4 C T 10: 42,860,732 probably benign Het
Sez6 T C 11: 77,953,702 V117A probably damaging Het
Sgsm2 A C 11: 74,865,424 C366W probably damaging Het
Slc12a4 T C 8: 105,944,250 probably null Het
Smg5 C T 3: 88,353,025 R641C probably damaging Het
Stxbp3 A G 3: 108,816,446 Y150H probably benign Het
Tkt T C 14: 30,569,084 F351S probably damaging Het
Tln1 A G 4: 43,547,618 L781P probably damaging Het
Triobp G A 15: 79,001,565 E1823K probably damaging Het
Ttll4 T C 1: 74,681,789 V538A possibly damaging Het
Vmn1r61 T A 7: 5,610,688 N209I possibly damaging Het
Wdr75 T A 1: 45,805,352 probably null Het
Zfp985 T C 4: 147,583,071 V132A probably benign Het
Zswim3 T A 2: 164,820,624 probably null Het
Other mutations in Rundc3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01150:Rundc3a APN 11 102393776 missense probably benign 0.43
IGL02206:Rundc3a APN 11 102399634 nonsense probably null
IGL02306:Rundc3a APN 11 102400938 missense probably damaging 1.00
IGL02838:Rundc3a APN 11 102397695 splice site probably benign
R0173:Rundc3a UTSW 11 102398245 unclassified probably benign
R1745:Rundc3a UTSW 11 102400913 frame shift probably null
R1746:Rundc3a UTSW 11 102400913 frame shift probably null
R2208:Rundc3a UTSW 11 102402088 missense probably damaging 1.00
R2366:Rundc3a UTSW 11 102397665 missense probably damaging 1.00
R2994:Rundc3a UTSW 11 102400663 missense probably damaging 1.00
R3755:Rundc3a UTSW 11 102399259 missense possibly damaging 0.48
R3756:Rundc3a UTSW 11 102399259 missense possibly damaging 0.48
R5519:Rundc3a UTSW 11 102402031 missense probably benign 0.01
R5748:Rundc3a UTSW 11 102399399 missense possibly damaging 0.63
R6361:Rundc3a UTSW 11 102400795 missense probably damaging 1.00
R6819:Rundc3a UTSW 11 102398461 nonsense probably null
R7324:Rundc3a UTSW 11 102399973 missense possibly damaging 0.80
R7369:Rundc3a UTSW 11 102399895 missense probably damaging 1.00
R7437:Rundc3a UTSW 11 102398404 missense probably damaging 1.00
R7439:Rundc3a UTSW 11 102400046 critical splice donor site probably null
R7441:Rundc3a UTSW 11 102400046 critical splice donor site probably null
R7542:Rundc3a UTSW 11 102400045 missense probably benign 0.44
R7802:Rundc3a UTSW 11 102400009 missense probably benign 0.18
Z1176:Rundc3a UTSW 11 102400991 missense probably benign 0.02
Z1177:Rundc3a UTSW 11 102398452 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTCACCGATGAAGACAGTTGG -3'
(R):5'- TGGGTGTCATCAGAAAAGCG -3'

Sequencing Primer
(F):5'- TTCGCATTGTCTACGCACAGAAG -3'
(R):5'- GGTGTCATCAGAAAAGCGATCCC -3'
Posted On2018-08-01