Incidental Mutation 'R6722:Nt5c1b'
ID529652
Institutional Source Beutler Lab
Gene Symbol Nt5c1b
Ensembl Gene ENSMUSG00000020622
Gene Name5'-nucleotidase, cytosolic IB
Synonyms4921514H13Rik, CN-IB
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6722 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location10369973-10390175 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 10372874 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 56 (Y56N)
Ref Sequence ENSEMBL: ENSMUSP00000151771 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002456] [ENSMUST00000118657] [ENSMUST00000143739] [ENSMUST00000147323] [ENSMUST00000217944] [ENSMUST00000218026] [ENSMUST00000218287] [ENSMUST00000218327] [ENSMUST00000218339] [ENSMUST00000218417] [ENSMUST00000218551] [ENSMUST00000219049] [ENSMUST00000219292] [ENSMUST00000219826] [ENSMUST00000220257] [ENSMUST00000220611] [ENSMUST00000223534]
Predicted Effect probably benign
Transcript: ENSMUST00000002456
AA Change: Y56N

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000002456
Gene: ENSMUSG00000020622
AA Change: Y56N

DomainStartEndE-ValueType
low complexity region 93 105 N/A INTRINSIC
low complexity region 137 145 N/A INTRINSIC
low complexity region 227 233 N/A INTRINSIC
Pfam:5-nucleotidase 298 570 1.6e-106 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118657
AA Change: Y56N

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000112694
Gene: ENSMUSG00000020622
AA Change: Y56N

DomainStartEndE-ValueType
low complexity region 91 103 N/A INTRINSIC
low complexity region 135 143 N/A INTRINSIC
low complexity region 225 231 N/A INTRINSIC
Pfam:5-nucleotidase 280 553 7e-112 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000143739
AA Change: Y56N
SMART Domains Protein: ENSMUSP00000123105
Gene: ENSMUSG00000020622
AA Change: Y56N

DomainStartEndE-ValueType
low complexity region 151 163 N/A INTRINSIC
low complexity region 195 203 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147323
AA Change: Y56N

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000117869
Gene: ENSMUSG00000020622
AA Change: Y56N

DomainStartEndE-ValueType
low complexity region 93 105 N/A INTRINSIC
low complexity region 137 145 N/A INTRINSIC
low complexity region 227 233 N/A INTRINSIC
Pfam:5-nucleotidase 298 466 4.8e-62 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000217944
AA Change: Y114N

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Predicted Effect probably benign
Transcript: ENSMUST00000218026
AA Change: Y56N

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218148
Predicted Effect probably benign
Transcript: ENSMUST00000218287
AA Change: Y114N

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
Predicted Effect unknown
Transcript: ENSMUST00000218288
AA Change: Y1N
Predicted Effect probably benign
Transcript: ENSMUST00000218327
AA Change: Y56N

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably benign
Transcript: ENSMUST00000218339
AA Change: Y56N

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
Predicted Effect probably benign
Transcript: ENSMUST00000218417
AA Change: Y114N

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
Predicted Effect probably benign
Transcript: ENSMUST00000218551
AA Change: Y56N

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
Predicted Effect possibly damaging
Transcript: ENSMUST00000219049
AA Change: Y56N

PolyPhen 2 Score 0.479 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect probably benign
Transcript: ENSMUST00000219292
AA Change: Y56N

PolyPhen 2 Score 0.124 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000219826
AA Change: Y114N

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Predicted Effect probably benign
Transcript: ENSMUST00000220257
AA Change: Y114N

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
Predicted Effect probably benign
Transcript: ENSMUST00000220611
AA Change: Y56N

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
Predicted Effect probably benign
Transcript: ENSMUST00000223534
AA Change: Y56N

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
Predicted Effect probably benign
Transcript: ENSMUST00000219630
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219281
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency 96% (52/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cytosolic 5-prime nucleotidases, such as NT5C1B, catalyze production of adenosine, which regulates diverse physiologic processes (Sala-Newby and Newby, 2001 [PubMed 11690631]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam4 T G 12: 81,421,454 D131A probably damaging Het
Ank3 T C 10: 69,990,244 probably benign Het
Arntl2 T A 6: 146,818,900 D187E probably damaging Het
Atp1a4 T C 1: 172,258,050 probably benign Het
BC005561 T A 5: 104,520,279 M889K probably damaging Het
Ccdc162 T C 10: 41,644,641 N673S probably benign Het
Cd84 G A 1: 171,872,777 V154M probably damaging Het
Celsr1 C A 15: 85,905,914 probably null Het
Cfap57 A C 4: 118,584,717 L718R probably damaging Het
Cntnap5b G A 1: 100,478,486 V803M probably damaging Het
Col6a2 C T 10: 76,614,558 V180I probably damaging Het
Coq4 A T 2: 29,788,285 probably benign Het
Cyp2a4 A G 7: 26,313,558 T389A probably benign Het
Dennd1c T C 17: 57,066,802 D587G probably benign Het
Dnaja4 A G 9: 54,699,754 D9G probably damaging Het
Gatsl2 T C 5: 134,135,619 S140P probably benign Het
Gm11808 A G 4: 3,973,386 Y59H probably benign Het
Hes2 T G 4: 152,160,377 L101R probably damaging Het
Icam2 A G 11: 106,382,481 S2P probably damaging Het
Krt31 A G 11: 100,048,428 L221P probably damaging Het
Lipm A T 19: 34,121,265 N380Y probably benign Het
Lrp2bp G A 8: 46,020,563 probably null Het
Mbd2 T A 18: 70,580,748 M216K probably damaging Het
Mrps33 T C 6: 39,805,665 probably benign Het
Nbeal2 T C 9: 110,632,992 D1459G probably damaging Het
Ncapd3 T C 9: 27,087,556 S1281P probably benign Het
Nthl1 A G 17: 24,634,034 K71E probably benign Het
Olfr1318 T A 2: 112,156,882 N310K probably benign Het
Parvb C T 15: 84,297,979 R237W probably damaging Het
Pde4a G A 9: 21,211,225 A806T probably damaging Het
Pde4d C A 13: 109,632,898 S40* probably null Het
Pde4dip G A 3: 97,718,239 R1348* probably null Het
Pdx1 C T 5: 147,270,500 P88S probably damaging Het
Pnisr T A 4: 21,859,165 V120D probably damaging Het
Prss51 G T 14: 64,095,059 C65F probably damaging Het
Pus10 G A 11: 23,702,975 E195K possibly damaging Het
Pzp T A 6: 128,487,954 Q1319L probably damaging Het
Rbpms G T 8: 33,834,393 T101K probably damaging Het
Rundc3a A G 11: 102,399,949 N281S possibly damaging Het
Scml4 C T 10: 42,860,732 probably benign Het
Sez6 T C 11: 77,953,702 V117A probably damaging Het
Sgsm2 A C 11: 74,865,424 C366W probably damaging Het
Slc12a4 T C 8: 105,944,250 probably null Het
Smg5 C T 3: 88,353,025 R641C probably damaging Het
Stxbp3 A G 3: 108,816,446 Y150H probably benign Het
Tkt T C 14: 30,569,084 F351S probably damaging Het
Tln1 A G 4: 43,547,618 L781P probably damaging Het
Triobp G A 15: 79,001,565 E1823K probably damaging Het
Ttll4 T C 1: 74,681,789 V538A possibly damaging Het
Vmn1r61 T A 7: 5,610,688 N209I possibly damaging Het
Wdr75 T A 1: 45,805,352 probably null Het
Zfp985 T C 4: 147,583,071 V132A probably benign Het
Zswim3 T A 2: 164,820,624 probably null Het
Other mutations in Nt5c1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01626:Nt5c1b APN 12 10374798 missense probably benign 0.00
IGL01737:Nt5c1b APN 12 10390108 missense possibly damaging 0.93
IGL02114:Nt5c1b APN 12 10375444 missense probably damaging 1.00
IGL02131:Nt5c1b APN 12 10375491 missense possibly damaging 0.75
IGL02135:Nt5c1b APN 12 10377194 missense probably damaging 1.00
IGL02871:Nt5c1b APN 12 10381325 missense probably damaging 1.00
IGL03003:Nt5c1b APN 12 10374910 missense possibly damaging 0.90
IGL03327:Nt5c1b APN 12 10374861 nonsense probably null
R0838:Nt5c1b UTSW 12 10375071 nonsense probably null
R1340:Nt5c1b UTSW 12 10377276 missense probably damaging 1.00
R1480:Nt5c1b UTSW 12 10374886 missense probably damaging 1.00
R1599:Nt5c1b UTSW 12 10390024 missense probably damaging 1.00
R1674:Nt5c1b UTSW 12 10370055 start gained probably benign
R1691:Nt5c1b UTSW 12 10375537 missense possibly damaging 0.95
R2237:Nt5c1b UTSW 12 10375558 missense probably damaging 0.96
R2238:Nt5c1b UTSW 12 10375558 missense probably damaging 0.96
R2238:Nt5c1b UTSW 12 10390108 missense probably damaging 1.00
R2239:Nt5c1b UTSW 12 10375558 missense probably damaging 0.96
R2260:Nt5c1b UTSW 12 10374965 missense probably damaging 1.00
R2424:Nt5c1b UTSW 12 10370072 missense probably damaging 1.00
R3607:Nt5c1b UTSW 12 10377236 missense probably damaging 1.00
R4276:Nt5c1b UTSW 12 10374886 missense probably damaging 1.00
R4582:Nt5c1b UTSW 12 10390054 missense probably damaging 1.00
R4711:Nt5c1b UTSW 12 10370093 missense probably damaging 1.00
R4775:Nt5c1b UTSW 12 10375449 missense probably damaging 1.00
R5840:Nt5c1b UTSW 12 10377171 missense probably damaging 1.00
R5940:Nt5c1b UTSW 12 10375515 missense probably damaging 1.00
R6104:Nt5c1b UTSW 12 10372955 missense probably damaging 1.00
R6329:Nt5c1b UTSW 12 10372138 nonsense probably null
R6626:Nt5c1b UTSW 12 10374837 nonsense probably null
R7424:Nt5c1b UTSW 12 10381391 splice site probably null
R7491:Nt5c1b UTSW 12 10374903 missense probably benign 0.00
R7714:Nt5c1b UTSW 12 10375472 missense probably damaging 1.00
R8008:Nt5c1b UTSW 12 10375000 missense possibly damaging 0.59
Predicted Primers PCR Primer
(F):5'- ATGCTGAAGTTAGGATTGAGCC -3'
(R):5'- CCAGAACAGGGTCTAAACACTTTG -3'

Sequencing Primer
(F):5'- CCTAGACTGAATCAAGGGTCG -3'
(R):5'- GATGGCAGTATTCCTGCT -3'
Posted On2018-08-01