Incidental Mutation 'R6722:Adam4'
ID529653
Institutional Source Beutler Lab
Gene Symbol Adam4
Ensembl Gene ENSMUSG00000072972
Gene Namea disintegrin and metallopeptidase domain 4
SynonymstMDCV
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R6722 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location81419443-81421946 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 81421454 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 131 (D131A)
Ref Sequence ENSEMBL: ENSMUSP00000082427 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085319] [ENSMUST00000110340] [ENSMUST00000164386] [ENSMUST00000166723]
Predicted Effect probably damaging
Transcript: ENSMUST00000085319
AA Change: D131A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000082427
Gene: ENSMUSG00000072972
AA Change: D131A

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Pfam:Pep_M12B_propep 46 163 9e-19 PFAM
Pfam:Reprolysin 213 406 1.3e-16 PFAM
DISIN 429 504 4.89e-37 SMART
ACR 505 648 2.28e-57 SMART
transmembrane domain 718 740 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110340
SMART Domains Protein: ENSMUSP00000105969
Gene: ENSMUSG00000091803

DomainStartEndE-ValueType
Pfam:COX16 16 74 6.6e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164386
SMART Domains Protein: ENSMUSP00000132941
Gene: ENSMUSG00000021139

DomainStartEndE-ValueType
PDZ 21 100 6.16e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166723
SMART Domains Protein: ENSMUSP00000130935
Gene: ENSMUSG00000091803

DomainStartEndE-ValueType
Pfam:COX16 16 73 6.9e-16 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency 96% (52/54)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank3 T C 10: 69,990,244 probably benign Het
Arntl2 T A 6: 146,818,900 D187E probably damaging Het
Atp1a4 T C 1: 172,258,050 probably benign Het
BC005561 T A 5: 104,520,279 M889K probably damaging Het
Ccdc162 T C 10: 41,644,641 N673S probably benign Het
Cd84 G A 1: 171,872,777 V154M probably damaging Het
Celsr1 C A 15: 85,905,914 probably null Het
Cfap57 A C 4: 118,584,717 L718R probably damaging Het
Cntnap5b G A 1: 100,478,486 V803M probably damaging Het
Col6a2 C T 10: 76,614,558 V180I probably damaging Het
Coq4 A T 2: 29,788,285 probably benign Het
Cyp2a4 A G 7: 26,313,558 T389A probably benign Het
Dennd1c T C 17: 57,066,802 D587G probably benign Het
Dnaja4 A G 9: 54,699,754 D9G probably damaging Het
Gatsl2 T C 5: 134,135,619 S140P probably benign Het
Gm11808 A G 4: 3,973,386 Y59H probably benign Het
Hes2 T G 4: 152,160,377 L101R probably damaging Het
Icam2 A G 11: 106,382,481 S2P probably damaging Het
Krt31 A G 11: 100,048,428 L221P probably damaging Het
Lipm A T 19: 34,121,265 N380Y probably benign Het
Lrp2bp G A 8: 46,020,563 probably null Het
Mbd2 T A 18: 70,580,748 M216K probably damaging Het
Mrps33 T C 6: 39,805,665 probably benign Het
Nbeal2 T C 9: 110,632,992 D1459G probably damaging Het
Ncapd3 T C 9: 27,087,556 S1281P probably benign Het
Nt5c1b T A 12: 10,372,874 Y56N possibly damaging Het
Nthl1 A G 17: 24,634,034 K71E probably benign Het
Olfr1318 T A 2: 112,156,882 N310K probably benign Het
Parvb C T 15: 84,297,979 R237W probably damaging Het
Pde4a G A 9: 21,211,225 A806T probably damaging Het
Pde4d C A 13: 109,632,898 S40* probably null Het
Pde4dip G A 3: 97,718,239 R1348* probably null Het
Pdx1 C T 5: 147,270,500 P88S probably damaging Het
Pnisr T A 4: 21,859,165 V120D probably damaging Het
Prss51 G T 14: 64,095,059 C65F probably damaging Het
Pus10 G A 11: 23,702,975 E195K possibly damaging Het
Pzp T A 6: 128,487,954 Q1319L probably damaging Het
Rbpms G T 8: 33,834,393 T101K probably damaging Het
Rundc3a A G 11: 102,399,949 N281S possibly damaging Het
Scml4 C T 10: 42,860,732 probably benign Het
Sez6 T C 11: 77,953,702 V117A probably damaging Het
Sgsm2 A C 11: 74,865,424 C366W probably damaging Het
Slc12a4 T C 8: 105,944,250 probably null Het
Smg5 C T 3: 88,353,025 R641C probably damaging Het
Stxbp3 A G 3: 108,816,446 Y150H probably benign Het
Tkt T C 14: 30,569,084 F351S probably damaging Het
Tln1 A G 4: 43,547,618 L781P probably damaging Het
Triobp G A 15: 79,001,565 E1823K probably damaging Het
Ttll4 T C 1: 74,681,789 V538A possibly damaging Het
Vmn1r61 T A 7: 5,610,688 N209I possibly damaging Het
Wdr75 T A 1: 45,805,352 probably null Het
Zfp985 T C 4: 147,583,071 V132A probably benign Het
Zswim3 T A 2: 164,820,624 probably null Het
Other mutations in Adam4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00972:Adam4 APN 12 81420649 missense probably damaging 0.96
IGL01133:Adam4 APN 12 81421446 missense possibly damaging 0.53
IGL01636:Adam4 APN 12 81419949 missense possibly damaging 0.81
IGL02133:Adam4 APN 12 81420029 missense probably benign 0.37
IGL02137:Adam4 APN 12 81421103 missense possibly damaging 0.91
IGL02425:Adam4 APN 12 81421328 missense probably benign 0.07
IGL02686:Adam4 APN 12 81421674 missense possibly damaging 0.88
R0554:Adam4 UTSW 12 81421424 missense probably damaging 1.00
R0684:Adam4 UTSW 12 81419654 missense probably damaging 1.00
R1519:Adam4 UTSW 12 81420877 missense possibly damaging 0.67
R1636:Adam4 UTSW 12 81419690 missense probably damaging 0.98
R1795:Adam4 UTSW 12 81421294 missense probably benign 0.03
R1835:Adam4 UTSW 12 81419559 missense probably benign 0.00
R2158:Adam4 UTSW 12 81421763 missense probably damaging 1.00
R2393:Adam4 UTSW 12 81420711 missense probably benign 0.02
R2923:Adam4 UTSW 12 81420744 missense probably damaging 1.00
R3411:Adam4 UTSW 12 81419822 missense possibly damaging 0.64
R4159:Adam4 UTSW 12 81420032 missense probably damaging 0.99
R4509:Adam4 UTSW 12 81421747 nonsense probably null
R4673:Adam4 UTSW 12 81421761 missense possibly damaging 0.56
R4794:Adam4 UTSW 12 81421424 missense probably damaging 0.99
R5564:Adam4 UTSW 12 81419574 missense probably benign 0.00
R5774:Adam4 UTSW 12 81420686 missense probably damaging 1.00
R6054:Adam4 UTSW 12 81420054 missense probably damaging 0.99
R6857:Adam4 UTSW 12 81419949 missense possibly damaging 0.81
R7316:Adam4 UTSW 12 81419724 missense probably benign 0.08
R7393:Adam4 UTSW 12 81419660 missense probably benign 0.01
R7649:Adam4 UTSW 12 81420377 missense probably damaging 1.00
R8245:Adam4 UTSW 12 81419883 missense probably damaging 1.00
R8293:Adam4 UTSW 12 81420411 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGCCAGCTTGGTCTCTTCAG -3'
(R):5'- GCACATCACCTATAGCATGCG -3'

Sequencing Primer
(F):5'- TCAGAGAGGTCACCTGCCTTTG -3'
(R):5'- CATGCGCTTTAGGGGACAAAGAC -3'
Posted On2018-08-01