Mutagenetix > Incidental Mutations

Incidental Mutation 'R6722:Triobp'

529657

Institutional Source

Beutler Lab

Gene Symbol

Triobp

Ensembl Gene

ENSMUSG00000033088

Gene Name

TRIO and F-actin binding protein

Synonyms

EST478828, Mus EST 478828, Tara

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6722 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

78947724-79005869 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 79001565 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Lysine at position 1823 (E1823K)

Ref Sequence

ENSEMBL: ENSMUSP00000105312 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000109687] [ENSMUST00000109688] [ENSMUST00000109689] [ENSMUST00000109690]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000109687
AA Change: E436K

PolyPhen 2 Score 0.864 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000105309
Gene: ENSMUSG00000033088
AA Change: E436K

Domain	Start	End	E-Value	Type
PH	7	104	6.2e-19	SMART
coiled coil region	277	304	N/A	INTRINSIC
coiled coil region	339	377	N/A	INTRINSIC
coiled coil region	401	463	N/A	INTRINSIC
coiled coil region	497	576	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000109688

SMART Domains

Protein: ENSMUSP00000105310
Gene: ENSMUSG00000033088

Domain	Start	End	E-Value	Type
low complexity region	6	21	N/A	INTRINSIC
low complexity region	30	47	N/A	INTRINSIC
PH	54	151	6.2e-19	SMART
coiled coil region	324	351	N/A	INTRINSIC
coiled coil region	386	424	N/A	INTRINSIC
coiled coil region	448	510	N/A	INTRINSIC
coiled coil region	544	623	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000109689
AA Change: E1777K

PolyPhen 2 Score 0.805 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000105311
Gene: ENSMUSG00000033088
AA Change: E1777K

Domain	Start	End	E-Value	Type
low complexity region	130	154	N/A	INTRINSIC
low complexity region	291	311	N/A	INTRINSIC
internal_repeat_1	312	394	7.43e-13	PROSPERO
internal_repeat_1	390	540	7.43e-13	PROSPERO
low complexity region	585	600	N/A	INTRINSIC
low complexity region	638	657	N/A	INTRINSIC
low complexity region	697	729	N/A	INTRINSIC
low complexity region	767	777	N/A	INTRINSIC
low complexity region	885	901	N/A	INTRINSIC
low complexity region	903	923	N/A	INTRINSIC
low complexity region	995	1017	N/A	INTRINSIC
low complexity region	1054	1068	N/A	INTRINSIC
low complexity region	1221	1235	N/A	INTRINSIC
PH	1395	1492	6.2e-19	SMART
coiled coil region	1665	1692	N/A	INTRINSIC
coiled coil region	1727	1765	N/A	INTRINSIC
coiled coil region	1789	1851	N/A	INTRINSIC
coiled coil region	1885	1964	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000109690
AA Change: E1823K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000105312
Gene: ENSMUSG00000033088
AA Change: E1823K

Domain	Start	End	E-Value	Type
low complexity region	130	154	N/A	INTRINSIC
low complexity region	291	311	N/A	INTRINSIC
internal_repeat_1	312	394	9.24e-13	PROSPERO
internal_repeat_1	390	540	9.24e-13	PROSPERO
low complexity region	585	600	N/A	INTRINSIC
low complexity region	638	657	N/A	INTRINSIC
low complexity region	697	729	N/A	INTRINSIC
low complexity region	767	777	N/A	INTRINSIC
low complexity region	885	901	N/A	INTRINSIC
low complexity region	903	923	N/A	INTRINSIC
low complexity region	995	1017	N/A	INTRINSIC
low complexity region	1054	1068	N/A	INTRINSIC
low complexity region	1221	1235	N/A	INTRINSIC
PH	1441	1538	6.2e-19	SMART
coiled coil region	1711	1738	N/A	INTRINSIC
coiled coil region	1773	1811	N/A	INTRINSIC
coiled coil region	1835	1897	N/A	INTRINSIC
coiled coil region	1931	2010	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129922

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183598

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229535

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230425

Meta Mutation Damage Score

0.2030

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 95.0%

Validation Efficiency

96% (52/54)

MGI Phenotype

FUNCTION: This gene encodes a protein that interacts with trio, which is involved with neural tissue development and controlling actin cytoskeleton organization, cell motility, and cell growth. The encoded protein also associates with F-actin and stabilizes F-actin structures. Domains contained in this encoded protein are an N-terminal pleckstrin homology domain and a C-terminal coiled-coil region. Mutations in the human gene have been associated with a form of autosomal recessive nonsyndromic deafness. Multiple alternatively spliced transcript variants have been described [provided by RefSeq, Sep 2012]
PHENOTYPE: Mice homozygous for gene trapped alleles exhibit embryonic lethality. Mice homozygous for a targeted allele eliminating isoforms 4 and 5 exhibit profound deafness associated with stereocilia fragility and degeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam4	T	G	12: 81,421,454	D131A	probably damaging	Het
Ank3	T	C	10: 69,990,244		probably benign	Het
Arntl2	T	A	6: 146,818,900	D187E	probably damaging	Het
Atp1a4	T	C	1: 172,258,050		probably benign	Het
BC005561	T	A	5: 104,520,279	M889K	probably damaging	Het
Ccdc162	T	C	10: 41,644,641	N673S	probably benign	Het
Cd84	G	A	1: 171,872,777	V154M	probably damaging	Het
Celsr1	C	A	15: 85,905,914		probably null	Het
Cfap57	A	C	4: 118,584,717	L718R	probably damaging	Het
Cntnap5b	G	A	1: 100,478,486	V803M	probably damaging	Het
Col6a2	C	T	10: 76,614,558	V180I	probably damaging	Het
Coq4	A	T	2: 29,788,285		probably benign	Het
Cyp2a4	A	G	7: 26,313,558	T389A	probably benign	Het
Dennd1c	T	C	17: 57,066,802	D587G	probably benign	Het
Dnaja4	A	G	9: 54,699,754	D9G	probably damaging	Het
Gatsl2	T	C	5: 134,135,619	S140P	probably benign	Het
Gm11808	A	G	4: 3,973,386	Y59H	probably benign	Het
Hes2	T	G	4: 152,160,377	L101R	probably damaging	Het
Icam2	A	G	11: 106,382,481	S2P	probably damaging	Het
Krt31	A	G	11: 100,048,428	L221P	probably damaging	Het
Lipm	A	T	19: 34,121,265	N380Y	probably benign	Het
Lrp2bp	G	A	8: 46,020,563		probably null	Het
Mbd2	T	A	18: 70,580,748	M216K	probably damaging	Het
Mrps33	T	C	6: 39,805,665		probably benign	Het
Nbeal2	T	C	9: 110,632,992	D1459G	probably damaging	Het
Ncapd3	T	C	9: 27,087,556	S1281P	probably benign	Het
Nt5c1b	T	A	12: 10,372,874	Y56N	possibly damaging	Het
Nthl1	A	G	17: 24,634,034	K71E	probably benign	Het
Olfr1318	T	A	2: 112,156,882	N310K	probably benign	Het
Parvb	C	T	15: 84,297,979	R237W	probably damaging	Het
Pde4a	G	A	9: 21,211,225	A806T	probably damaging	Het
Pde4d	C	A	13: 109,632,898	S40*	probably null	Het
Pde4dip	G	A	3: 97,718,239	R1348*	probably null	Het
Pdx1	C	T	5: 147,270,500	P88S	probably damaging	Het
Pnisr	T	A	4: 21,859,165	V120D	probably damaging	Het
Prss51	G	T	14: 64,095,059	C65F	probably damaging	Het
Pus10	G	A	11: 23,702,975	E195K	possibly damaging	Het
Pzp	T	A	6: 128,487,954	Q1319L	probably damaging	Het
Rbpms	G	T	8: 33,834,393	T101K	probably damaging	Het
Rundc3a	A	G	11: 102,399,949	N281S	possibly damaging	Het
Scml4	C	T	10: 42,860,732		probably benign	Het
Sez6	T	C	11: 77,953,702	V117A	probably damaging	Het
Sgsm2	A	C	11: 74,865,424	C366W	probably damaging	Het
Slc12a4	T	C	8: 105,944,250		probably null	Het
Smg5	C	T	3: 88,353,025	R641C	probably damaging	Het
Stxbp3	A	G	3: 108,816,446	Y150H	probably benign	Het
Tkt	T	C	14: 30,569,084	F351S	probably damaging	Het
Tln1	A	G	4: 43,547,618	L781P	probably damaging	Het
Ttll4	T	C	1: 74,681,789	V538A	possibly damaging	Het
Vmn1r61	T	A	7: 5,610,688	N209I	possibly damaging	Het
Wdr75	T	A	1: 45,805,352		probably null	Het
Zfp985	T	C	4: 147,583,071	V132A	probably benign	Het
Zswim3	T	A	2: 164,820,624		probably null	Het

Other mutations in Triobp

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01634:Triobp	APN	15	78993368	missense	probably damaging	1.00
IGL01904:Triobp	APN	15	78967364	missense	possibly damaging	0.80
IGL01957:Triobp	APN	15	78972647	critical splice donor site	probably null
IGL02085:Triobp	APN	15	78974297	splice site	probably benign
IGL02260:Triobp	APN	15	78966362	missense	probably benign	0.00
IGL02498:Triobp	APN	15	78961043	missense	probably benign	0.01
IGL02551:Triobp	APN	15	78973489	missense	probably benign
IGL02740:Triobp	APN	15	78966689	missense	probably benign	0.21
IGL02810:Triobp	APN	15	79002203	missense	possibly damaging	0.95
IGL03063:Triobp	APN	15	78990884	missense	probably damaging	1.00
FR4304:Triobp	UTSW	15	78993387	unclassified	probably benign
FR4340:Triobp	UTSW	15	78993390	unclassified	probably benign
FR4342:Triobp	UTSW	15	78993392	unclassified	probably benign
FR4449:Triobp	UTSW	15	78993389	unclassified	probably benign
FR4548:Triobp	UTSW	15	78993387	unclassified	probably benign
FR4548:Triobp	UTSW	15	78993390	unclassified	probably benign
R0276:Triobp	UTSW	15	78973676	missense	probably benign	0.09
R0309:Triobp	UTSW	15	78976540	missense	probably damaging	1.00
R0433:Triobp	UTSW	15	78968201	missense	possibly damaging	0.69
R0464:Triobp	UTSW	15	78966986	missense	possibly damaging	0.71
R0525:Triobp	UTSW	15	78973898	missense	possibly damaging	0.93
R0665:Triobp	UTSW	15	78973898	missense	possibly damaging	0.93
R0689:Triobp	UTSW	15	78959988	nonsense	probably null
R1149:Triobp	UTSW	15	78966479	missense	probably benign	0.00
R1149:Triobp	UTSW	15	78966479	missense	probably benign	0.00
R1151:Triobp	UTSW	15	78966479	missense	probably benign	0.00
R1152:Triobp	UTSW	15	78966479	missense	probably benign	0.00
R1510:Triobp	UTSW	15	79003767	missense	probably damaging	1.00
R1519:Triobp	UTSW	15	78973738	missense	probably benign	0.00
R1642:Triobp	UTSW	15	79002148	missense	probably damaging	1.00
R1732:Triobp	UTSW	15	78967228	missense	possibly damaging	0.69
R1755:Triobp	UTSW	15	78966479	missense	probably benign	0.00
R1975:Triobp	UTSW	15	78966708	missense	probably benign
R2051:Triobp	UTSW	15	79004540	missense	probably damaging	1.00
R2073:Triobp	UTSW	15	78973895	missense	probably damaging	0.99
R2260:Triobp	UTSW	15	78991440	critical splice donor site	probably null
R2351:Triobp	UTSW	15	79004580	missense	probably benign	0.09
R2902:Triobp	UTSW	15	78973418	missense	possibly damaging	0.90
R3801:Triobp	UTSW	15	78973700	missense	probably benign	0.04
R3959:Triobp	UTSW	15	79002389	nonsense	probably null
R4003:Triobp	UTSW	15	78959977	unclassified	probably benign
R4084:Triobp	UTSW	15	78973671	missense	probably benign	0.19
R4482:Triobp	UTSW	15	78966563	missense	possibly damaging	0.87
R4592:Triobp	UTSW	15	78967095	missense	probably benign
R4662:Triobp	UTSW	15	78993269	missense	probably damaging	1.00
R4732:Triobp	UTSW	15	78967113	missense	probably damaging	0.99
R4733:Triobp	UTSW	15	78967113	missense	probably damaging	0.99
R4789:Triobp	UTSW	15	78991028	missense	probably damaging	1.00
R4968:Triobp	UTSW	15	78966616	missense	probably benign	0.03
R4990:Triobp	UTSW	15	78967005	missense	probably benign	0.00
R5129:Triobp	UTSW	15	78961096	missense	probably benign	0.15
R5181:Triobp	UTSW	15	78967754	missense	probably benign	0.00
R5279:Triobp	UTSW	15	78994391	missense	possibly damaging	0.66
R5584:Triobp	UTSW	15	78968132	missense	possibly damaging	0.89
R5601:Triobp	UTSW	15	78973633	missense	probably damaging	1.00
R5810:Triobp	UTSW	15	78968267	missense	probably benign	0.07
R5969:Triobp	UTSW	15	78967540	missense	probably benign	0.05
R6739:Triobp	UTSW	15	78966366	missense	possibly damaging	0.77
R6810:Triobp	UTSW	15	78966615	missense	possibly damaging	0.47
R7011:Triobp	UTSW	15	78978723	missense	probably damaging	0.98
R7015:Triobp	UTSW	15	78994060	missense	probably damaging	0.99
R7200:Triobp	UTSW	15	78966842	small deletion	probably benign
R7294:Triobp	UTSW	15	78973976	missense	probably damaging	0.99
R7688:Triobp	UTSW	15	78961111	splice site	probably null
R7805:Triobp	UTSW	15	78974004	missense	probably benign	0.37
R7972:Triobp	UTSW	15	78967986	missense	probably damaging	1.00
R7977:Triobp	UTSW	15	79001544	missense	probably damaging	1.00
R7987:Triobp	UTSW	15	79001544	missense	probably damaging	1.00
R7999:Triobp	UTSW	15	78959944	missense	probably damaging	0.99
R8344:Triobp	UTSW	15	78958275	missense	possibly damaging	0.67
R8348:Triobp	UTSW	15	78994126	missense	possibly damaging	0.85
R8446:Triobp	UTSW	15	78994126	missense	possibly damaging	0.85
R8448:Triobp	UTSW	15	78994126	missense	possibly damaging	0.85
R8469:Triobp	UTSW	15	78967019	missense	probably benign	0.00
R8491:Triobp	UTSW	15	78994126	missense	possibly damaging	0.85
R8492:Triobp	UTSW	15	78994126	missense	possibly damaging	0.85
R8493:Triobp	UTSW	15	78994126	missense	possibly damaging	0.85
RF001:Triobp	UTSW	15	78967027	small insertion	probably benign
RF005:Triobp	UTSW	15	78967061	small insertion	probably benign
RF007:Triobp	UTSW	15	78967044	small insertion	probably benign
RF022:Triobp	UTSW	15	78974282	missense	probably benign	0.05
RF028:Triobp	UTSW	15	78967039	small insertion	probably benign
RF032:Triobp	UTSW	15	78967036	small insertion	probably benign
RF035:Triobp	UTSW	15	78967039	small insertion	probably benign
RF039:Triobp	UTSW	15	78967036	small insertion	probably benign
RF039:Triobp	UTSW	15	78967039	small insertion	probably benign
RF040:Triobp	UTSW	15	78967063	small insertion	probably benign
RF049:Triobp	UTSW	15	78967061	small insertion	probably benign
RF051:Triobp	UTSW	15	78967034	small insertion	probably benign
RF058:Triobp	UTSW	15	78967044	small insertion	probably benign
X0026:Triobp	UTSW	15	78960023	missense	possibly damaging	0.94
Z1177:Triobp	UTSW	15	79002181	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CACACAGGATTGCCTCAAAGGG -3'
(R):5'- CTTGGGCACTGTTGACTCATG -3'

Sequencing Primer
(F):5'- GAGGTTGACCAGCTCTCACAAAG -3'
(R):5'- GACTCATGTGATCTCTGCCAAGG -3'

Posted On

2018-08-01