Incidental Mutation 'R6722:Parvb'
ID529658
Institutional Source Beutler Lab
Gene Symbol Parvb
Ensembl Gene ENSMUSG00000022438
Gene Nameparvin, beta
Synonymsaffixin, D15Gsk1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6722 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location84232043-84315688 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 84297979 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 237 (R237W)
Ref Sequence ENSEMBL: ENSMUSP00000023072 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023072]
Predicted Effect probably damaging
Transcript: ENSMUST00000023072
AA Change: R237W

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000023072
Gene: ENSMUSG00000022438
AA Change: R237W

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
CH 90 190 3.46e-1 SMART
low complexity region 204 211 N/A INTRINSIC
CH 257 360 9.18e-2 SMART
Meta Mutation Damage Score 0.2669 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency 96% (52/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the parvin family of actin-binding proteins, which play a role in cytoskeleton organization and cell adhesion. These proteins are associated with focal contacts and contain calponin homology domains that bind to actin filaments. This family member binds to alphaPIX and alpha-actinin, and it can inhibit the activity of integrin-linked kinase. This protein also functions in tumor suppression. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Aug 2011]
PHENOTYPE: Disruption of this marker has no apparent adverse consequences. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam4 T G 12: 81,421,454 D131A probably damaging Het
Ank3 T C 10: 69,990,244 probably benign Het
Arntl2 T A 6: 146,818,900 D187E probably damaging Het
Atp1a4 T C 1: 172,258,050 probably benign Het
BC005561 T A 5: 104,520,279 M889K probably damaging Het
Ccdc162 T C 10: 41,644,641 N673S probably benign Het
Cd84 G A 1: 171,872,777 V154M probably damaging Het
Celsr1 C A 15: 85,905,914 probably null Het
Cfap57 A C 4: 118,584,717 L718R probably damaging Het
Cntnap5b G A 1: 100,478,486 V803M probably damaging Het
Col6a2 C T 10: 76,614,558 V180I probably damaging Het
Coq4 A T 2: 29,788,285 probably benign Het
Cyp2a4 A G 7: 26,313,558 T389A probably benign Het
Dennd1c T C 17: 57,066,802 D587G probably benign Het
Dnaja4 A G 9: 54,699,754 D9G probably damaging Het
Gatsl2 T C 5: 134,135,619 S140P probably benign Het
Gm11808 A G 4: 3,973,386 Y59H probably benign Het
Hes2 T G 4: 152,160,377 L101R probably damaging Het
Icam2 A G 11: 106,382,481 S2P probably damaging Het
Krt31 A G 11: 100,048,428 L221P probably damaging Het
Lipm A T 19: 34,121,265 N380Y probably benign Het
Lrp2bp G A 8: 46,020,563 probably null Het
Mbd2 T A 18: 70,580,748 M216K probably damaging Het
Mrps33 T C 6: 39,805,665 probably benign Het
Nbeal2 T C 9: 110,632,992 D1459G probably damaging Het
Ncapd3 T C 9: 27,087,556 S1281P probably benign Het
Nt5c1b T A 12: 10,372,874 Y56N possibly damaging Het
Nthl1 A G 17: 24,634,034 K71E probably benign Het
Olfr1318 T A 2: 112,156,882 N310K probably benign Het
Pde4a G A 9: 21,211,225 A806T probably damaging Het
Pde4d C A 13: 109,632,898 S40* probably null Het
Pde4dip G A 3: 97,718,239 R1348* probably null Het
Pdx1 C T 5: 147,270,500 P88S probably damaging Het
Pnisr T A 4: 21,859,165 V120D probably damaging Het
Prss51 G T 14: 64,095,059 C65F probably damaging Het
Pus10 G A 11: 23,702,975 E195K possibly damaging Het
Pzp T A 6: 128,487,954 Q1319L probably damaging Het
Rbpms G T 8: 33,834,393 T101K probably damaging Het
Rundc3a A G 11: 102,399,949 N281S possibly damaging Het
Scml4 C T 10: 42,860,732 probably benign Het
Sez6 T C 11: 77,953,702 V117A probably damaging Het
Sgsm2 A C 11: 74,865,424 C366W probably damaging Het
Slc12a4 T C 8: 105,944,250 probably null Het
Smg5 C T 3: 88,353,025 R641C probably damaging Het
Stxbp3 A G 3: 108,816,446 Y150H probably benign Het
Tkt T C 14: 30,569,084 F351S probably damaging Het
Tln1 A G 4: 43,547,618 L781P probably damaging Het
Triobp G A 15: 79,001,565 E1823K probably damaging Het
Ttll4 T C 1: 74,681,789 V538A possibly damaging Het
Vmn1r61 T A 7: 5,610,688 N209I possibly damaging Het
Wdr75 T A 1: 45,805,352 probably null Het
Zfp985 T C 4: 147,583,071 V132A probably benign Het
Zswim3 T A 2: 164,820,624 probably null Het
Other mutations in Parvb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01610:Parvb APN 15 84303465 missense probably damaging 1.00
IGL02415:Parvb APN 15 84292815 missense probably damaging 1.00
IGL02458:Parvb APN 15 84303434 missense probably damaging 1.00
IGL02937:Parvb APN 15 84308953 missense probably damaging 1.00
IGL03088:Parvb APN 15 84308843 splice site probably benign
R0422:Parvb UTSW 15 84295611 missense probably benign 0.28
R1470:Parvb UTSW 15 84271252 missense probably damaging 1.00
R1470:Parvb UTSW 15 84271308 missense probably benign 0.00
R1470:Parvb UTSW 15 84271252 missense probably damaging 1.00
R1470:Parvb UTSW 15 84271308 missense probably benign 0.00
R1713:Parvb UTSW 15 84297991 splice site probably benign
R2031:Parvb UTSW 15 84282835 missense probably benign 0.09
R2146:Parvb UTSW 15 84232168 missense possibly damaging 0.63
R2148:Parvb UTSW 15 84232168 missense possibly damaging 0.63
R2149:Parvb UTSW 15 84232168 missense possibly damaging 0.63
R2150:Parvb UTSW 15 84232168 missense possibly damaging 0.63
R2508:Parvb UTSW 15 84297970 missense probably benign
R4770:Parvb UTSW 15 84303905 critical splice donor site probably null
R5948:Parvb UTSW 15 84303461 missense probably damaging 1.00
R6492:Parvb UTSW 15 84303872 missense probably damaging 1.00
R6718:Parvb UTSW 15 84297979 missense probably damaging 0.96
R6719:Parvb UTSW 15 84297979 missense probably damaging 0.96
R6720:Parvb UTSW 15 84297979 missense probably damaging 0.96
R7189:Parvb UTSW 15 84303471 critical splice donor site probably null
R7285:Parvb UTSW 15 84282784 missense possibly damaging 0.94
R7492:Parvb UTSW 15 84290450 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CCCACGATGCAAATGATGTC -3'
(R):5'- AGAGATGTTCTCCAGGCTGG -3'

Sequencing Primer
(F):5'- TGTCCTCTCTAAATGATACACCAGGG -3'
(R):5'- GGCCCCTCTGTCCCTACAAG -3'
Posted On2018-08-01