Incidental Mutation 'R6723:Mff'
ID529665
Institutional Source Beutler Lab
Gene Symbol Mff
Ensembl Gene ENSMUSG00000026150
Gene Namemitochondrial fission factor
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.291) question?
Stock #R6723 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location82724890-82752394 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 82751666 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 122 (I122V)
Ref Sequence ENSEMBL: ENSMUSP00000125629 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027331] [ENSMUST00000073025] [ENSMUST00000078332] [ENSMUST00000160744] [ENSMUST00000160786] [ENSMUST00000160972] [ENSMUST00000161648] [ENSMUST00000162003]
Predicted Effect probably benign
Transcript: ENSMUST00000027331
SMART Domains Protein: ENSMUSP00000027331
Gene: ENSMUSG00000026149

DomainStartEndE-ValueType
Pfam:L6_membrane 2 220 8.1e-61 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000073025
AA Change: I224V

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000072784
Gene: ENSMUSG00000026150
AA Change: I224V

DomainStartEndE-ValueType
Pfam:Miff 1 239 6.6e-101 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000078332
AA Change: I276V

PolyPhen 2 Score 0.411 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000077446
Gene: ENSMUSG00000026150
AA Change: I276V

DomainStartEndE-ValueType
Pfam:Miff 1 291 2.2e-100 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160044
SMART Domains Protein: ENSMUSP00000125005
Gene: ENSMUSG00000026150

DomainStartEndE-ValueType
Pfam:Miff 1 130 7.5e-52 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160632
Predicted Effect possibly damaging
Transcript: ENSMUST00000160744
AA Change: I122V

PolyPhen 2 Score 0.911 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000125629
Gene: ENSMUSG00000026150
AA Change: I122V

DomainStartEndE-ValueType
Pfam:Miff 1 137 2.6e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160750
SMART Domains Protein: ENSMUSP00000125223
Gene: ENSMUSG00000026150

DomainStartEndE-ValueType
Pfam:Miff 1 155 6.2e-67 PFAM
Pfam:Miff 144 220 2.6e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160786
AA Change: I223V

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000125230
Gene: ENSMUSG00000026150
AA Change: I223V

DomainStartEndE-ValueType
Pfam:Miff 1 238 6e-101 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160972
AA Change: I203V

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000124200
Gene: ENSMUSG00000026150
AA Change: I203V

DomainStartEndE-ValueType
Pfam:Miff 1 152 8.1e-60 PFAM
Pfam:Miff 146 218 1.8e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161648
AA Change: I228V

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000124164
Gene: ENSMUSG00000026150
AA Change: I228V

DomainStartEndE-ValueType
Pfam:Miff 1 243 1.1e-102 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162003
AA Change: I301V

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000124334
Gene: ENSMUSG00000026150
AA Change: I301V

DomainStartEndE-ValueType
Pfam:Miff 1 316 8.1e-143 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162573
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162794
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous knockout reduces mitochondrial hyperfusion-induced apoptotic cell death of endothelial cells of cardiac microvessels after induced ischemia/reperfusion injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T C 10: 82,289,823 Y2451C possibly damaging Het
Ahnak2 A G 12: 112,778,793 S740P probably damaging Het
Akt3 A T 1: 177,050,190 Y337* probably null Het
Bcl11a C A 11: 24,163,646 P330T probably damaging Het
Cyp2d12 A T 15: 82,556,884 I124F probably benign Het
Dhdds T C 4: 133,994,265 T74A probably damaging Het
Dio3 G A 12: 110,279,557 C109Y possibly damaging Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dock7 A G 4: 99,003,916 V811A possibly damaging Het
Efcab3 A T 11: 105,117,080 T329S possibly damaging Het
Esp1 A T 17: 40,728,856 I11L probably benign Het
Fam13b A T 18: 34,498,026 H33Q possibly damaging Het
Fam13c G A 10: 70,554,525 D539N probably damaging Het
Fgd5 A G 6: 91,988,030 T257A probably benign Het
Gm5134 A G 10: 76,008,619 D603G probably benign Het
Gtpbp2 T C 17: 46,168,276 V588A probably benign Het
Ift140 A G 17: 25,033,116 I312M probably benign Het
Inpp5j T C 11: 3,500,640 N571S probably damaging Het
Iqgap1 T G 7: 80,723,822 D1473A probably benign Het
Ivl T G 3: 92,571,387 K457T unknown Het
Kdm3b T C 18: 34,793,005 I66T probably damaging Het
Kif21a A T 15: 90,940,446 M1430K probably damaging Het
Klhl25 T A 7: 75,865,991 L215Q possibly damaging Het
Lim2 T A 7: 43,435,675 M163K probably benign Het
Lrig1 T C 6: 94,626,405 D254G probably damaging Het
Mrpl15 A C 1: 4,782,566 probably null Het
Mylk A G 16: 34,929,888 Y1199C possibly damaging Het
Nlrp3 G A 11: 59,565,192 C938Y probably damaging Het
Notch1 T C 2: 26,478,106 N623D probably damaging Het
Obscn T G 11: 59,054,998 E4129A probably damaging Het
Olfr1221 G T 2: 89,112,296 T72N possibly damaging Het
Olfr1423 A G 19: 12,036,275 S156P probably damaging Het
Olfr173 T C 16: 58,797,432 K138R probably benign Het
Olfr517 A T 7: 108,868,588 C189S probably damaging Het
Olfr808 A T 10: 129,768,415 L306F probably benign Het
Parm1 C T 5: 91,622,997 P291S probably damaging Het
Pcsk1 T A 13: 75,093,069 probably null Het
Pi4ka A G 16: 17,376,982 L184P possibly damaging Het
Piezo1 T G 8: 122,507,627 Q93H probably benign Het
Pkd2l2 A T 18: 34,438,157 Y575F probably damaging Het
Plekhn1 A C 4: 156,224,569 F258C probably damaging Het
Pole C T 5: 110,323,616 H1409Y probably benign Het
Rae1 T C 2: 173,012,248 I273T probably damaging Het
Rag1 A G 2: 101,643,645 V384A probably damaging Het
Rnaseh1 T C 12: 28,649,762 L25P probably damaging Het
Serpinb12 A G 1: 106,949,158 H68R probably benign Het
Sh3tc2 A T 18: 61,977,954 I294F probably damaging Het
Sirpb1b A C 3: 15,548,798 L75V possibly damaging Het
Slc12a6 A T 2: 112,337,942 T277S probably damaging Het
Slc7a12 A T 3: 14,499,197 E43D probably benign Het
Spata31d1c T A 13: 65,035,944 D433E probably benign Het
Tbl2 A T 5: 135,159,276 Y308F probably damaging Het
Tfec T C 6: 16,835,302 Y159C probably damaging Het
Tmem8 C A 17: 26,120,636 T616N probably damaging Het
Top1mt G T 15: 75,667,433 T371K probably benign Het
Trim24 T C 6: 37,951,468 V541A probably benign Het
Ttc16 T C 2: 32,768,037 Y456C possibly damaging Het
Ttn G A 2: 76,770,097 R17204* probably null Het
Ugt1a6b T C 1: 88,107,717 V259A probably benign Het
Unc5a T C 13: 54,995,889 W129R probably benign Het
Vmn1r63 T A 7: 5,802,949 H228L probably damaging Het
Whamm G T 7: 81,596,120 V775F probably damaging Het
Zfc3h1 T A 10: 115,420,733 I1536N probably benign Het
Zfp1 T C 8: 111,670,339 S317P probably damaging Het
Zfp58 T C 13: 67,494,073 T52A probably damaging Het
Other mutations in Mff
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02002:Mff APN 1 82741975 missense probably damaging 1.00
IGL02934:Mff APN 1 82747094 missense probably damaging 1.00
IGL03381:Mff APN 1 82741940 missense probably damaging 1.00
R0652:Mff UTSW 1 82750564 missense possibly damaging 0.91
R0755:Mff UTSW 1 82750605 critical splice donor site probably null
R1215:Mff UTSW 1 82741888 missense probably benign 0.45
R2074:Mff UTSW 1 82751700 missense probably damaging 1.00
R2078:Mff UTSW 1 82741921 missense probably damaging 1.00
R2365:Mff UTSW 1 82735471 missense possibly damaging 0.74
R4498:Mff UTSW 1 82741780 intron probably benign
R5099:Mff UTSW 1 82750471 intron probably benign
R5867:Mff UTSW 1 82750606 critical splice donor site probably null
R5984:Mff UTSW 1 82731127 missense probably benign 0.00
R7135:Mff UTSW 1 82747091 nonsense probably null
R7373:Mff UTSW 1 82737117 splice site probably null
R7475:Mff UTSW 1 82745438 splice site probably null
R7792:Mff UTSW 1 82747081 critical splice acceptor site probably null
R8088:Mff UTSW 1 82751649 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATCAGTTTAAGCCATTGTGGG -3'
(R):5'- GCCTTCACTCTACAGATACAGG -3'

Sequencing Primer
(F):5'- TTTTGTTCATTTTGATCCAGAATGG -3'
(R):5'- TCTACAGATACAGGGCCTTCC -3'
Posted On2018-08-01