Incidental Mutation 'R6723:Top1mt'
ID529714
Institutional Source Beutler Lab
Gene Symbol Top1mt
Ensembl Gene ENSMUSG00000000934
Gene NameDNA topoisomerase 1, mitochondrial
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.353) question?
Stock #R6723 (G1)
Quality Score157.009
Status Not validated
Chromosome15
Chromosomal Location75657035-75678800 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 75667433 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 371 (T371K)
Ref Sequence ENSEMBL: ENSMUSP00000000958 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000958]
Predicted Effect probably benign
Transcript: ENSMUST00000000958
AA Change: T371K

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000000958
Gene: ENSMUSG00000000934
AA Change: T371K

DomainStartEndE-ValueType
Blast:TOPEUc 72 150 4e-38 BLAST
low complexity region 151 166 N/A INTRINSIC
TOPEUc 189 565 5.86e-230 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146755
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230469
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230774
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrial DNA topoisomerase that plays a role in the modification of DNA topology. The encoded protein is a type IB topoisomerase and catalyzes the transient breaking and rejoining of DNA to relieve tension and DNA supercoiling generated in the mitochondrial genome during replication and transcription. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, May 2012]
PHENOTYPE: Mice homozygous for a null allele display increased oxidative stress and lipid peroxidation, enhanced glycolysis, and mitochondrial abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T C 10: 82,289,823 Y2451C possibly damaging Het
Ahnak2 A G 12: 112,778,793 S740P probably damaging Het
Akt3 A T 1: 177,050,190 Y337* probably null Het
Bcl11a C A 11: 24,163,646 P330T probably damaging Het
Cyp2d12 A T 15: 82,556,884 I124F probably benign Het
Dhdds T C 4: 133,994,265 T74A probably damaging Het
Dio3 G A 12: 110,279,557 C109Y possibly damaging Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dock7 A G 4: 99,003,916 V811A possibly damaging Het
Efcab3 A T 11: 105,117,080 T329S possibly damaging Het
Esp1 A T 17: 40,728,856 I11L probably benign Het
Fam13b A T 18: 34,498,026 H33Q possibly damaging Het
Fam13c G A 10: 70,554,525 D539N probably damaging Het
Fgd5 A G 6: 91,988,030 T257A probably benign Het
Gm5134 A G 10: 76,008,619 D603G probably benign Het
Gtpbp2 T C 17: 46,168,276 V588A probably benign Het
Ift140 A G 17: 25,033,116 I312M probably benign Het
Inpp5j T C 11: 3,500,640 N571S probably damaging Het
Iqgap1 T G 7: 80,723,822 D1473A probably benign Het
Ivl T G 3: 92,571,387 K457T unknown Het
Kdm3b T C 18: 34,793,005 I66T probably damaging Het
Kif21a A T 15: 90,940,446 M1430K probably damaging Het
Klhl25 T A 7: 75,865,991 L215Q possibly damaging Het
Lim2 T A 7: 43,435,675 M163K probably benign Het
Lrig1 T C 6: 94,626,405 D254G probably damaging Het
Mff A G 1: 82,751,666 I122V possibly damaging Het
Mrpl15 A C 1: 4,782,566 probably null Het
Mylk A G 16: 34,929,888 Y1199C possibly damaging Het
Nlrp3 G A 11: 59,565,192 C938Y probably damaging Het
Notch1 T C 2: 26,478,106 N623D probably damaging Het
Obscn T G 11: 59,054,998 E4129A probably damaging Het
Olfr1221 G T 2: 89,112,296 T72N possibly damaging Het
Olfr1423 A G 19: 12,036,275 S156P probably damaging Het
Olfr173 T C 16: 58,797,432 K138R probably benign Het
Olfr517 A T 7: 108,868,588 C189S probably damaging Het
Olfr808 A T 10: 129,768,415 L306F probably benign Het
Parm1 C T 5: 91,622,997 P291S probably damaging Het
Pcsk1 T A 13: 75,093,069 probably null Het
Pi4ka A G 16: 17,376,982 L184P possibly damaging Het
Piezo1 T G 8: 122,507,627 Q93H probably benign Het
Pkd2l2 A T 18: 34,438,157 Y575F probably damaging Het
Plekhn1 A C 4: 156,224,569 F258C probably damaging Het
Pole C T 5: 110,323,616 H1409Y probably benign Het
Rae1 T C 2: 173,012,248 I273T probably damaging Het
Rag1 A G 2: 101,643,645 V384A probably damaging Het
Rnaseh1 T C 12: 28,649,762 L25P probably damaging Het
Serpinb12 A G 1: 106,949,158 H68R probably benign Het
Sh3tc2 A T 18: 61,977,954 I294F probably damaging Het
Sirpb1b A C 3: 15,548,798 L75V possibly damaging Het
Slc12a6 A T 2: 112,337,942 T277S probably damaging Het
Slc7a12 A T 3: 14,499,197 E43D probably benign Het
Spata31d1c T A 13: 65,035,944 D433E probably benign Het
Tbl2 A T 5: 135,159,276 Y308F probably damaging Het
Tfec T C 6: 16,835,302 Y159C probably damaging Het
Tmem8 C A 17: 26,120,636 T616N probably damaging Het
Trim24 T C 6: 37,951,468 V541A probably benign Het
Ttc16 T C 2: 32,768,037 Y456C possibly damaging Het
Ttn G A 2: 76,770,097 R17204* probably null Het
Ugt1a6b T C 1: 88,107,717 V259A probably benign Het
Unc5a T C 13: 54,995,889 W129R probably benign Het
Vmn1r63 T A 7: 5,802,949 H228L probably damaging Het
Whamm G T 7: 81,596,120 V775F probably damaging Het
Zfc3h1 T A 10: 115,420,733 I1536N probably benign Het
Zfp1 T C 8: 111,670,339 S317P probably damaging Het
Zfp58 T C 13: 67,494,073 T52A probably damaging Het
Other mutations in Top1mt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01925:Top1mt APN 15 75657143 missense possibly damaging 0.47
IGL02111:Top1mt APN 15 75665706 splice site probably benign
IGL02425:Top1mt APN 15 75676121 missense probably benign
IGL02662:Top1mt APN 15 75668705 missense probably damaging 1.00
R1240:Top1mt UTSW 15 75670067 missense probably damaging 0.99
R1438:Top1mt UTSW 15 75674398 missense probably damaging 1.00
R1732:Top1mt UTSW 15 75666251 critical splice donor site probably null
R1884:Top1mt UTSW 15 75667901 missense possibly damaging 0.81
R3413:Top1mt UTSW 15 75657176 missense probably benign 0.41
R3414:Top1mt UTSW 15 75657176 missense probably benign 0.41
R4677:Top1mt UTSW 15 75664058 missense possibly damaging 0.48
R4784:Top1mt UTSW 15 75657703 missense probably damaging 1.00
R4784:Top1mt UTSW 15 75676031 missense possibly damaging 0.88
R4791:Top1mt UTSW 15 75668625 critical splice donor site probably null
R6339:Top1mt UTSW 15 75665656 missense possibly damaging 0.72
R6732:Top1mt UTSW 15 75669488 splice site probably null
R6841:Top1mt UTSW 15 75676124 missense probably benign 0.00
R6884:Top1mt UTSW 15 75664044 missense probably benign 0.37
R7024:Top1mt UTSW 15 75667448 missense probably damaging 1.00
R7052:Top1mt UTSW 15 75668711 missense possibly damaging 0.82
R7055:Top1mt UTSW 15 75678674 missense probably benign 0.01
R7273:Top1mt UTSW 15 75664082 missense probably benign 0.27
R8032:Top1mt UTSW 15 75668723 missense probably damaging 1.00
X0028:Top1mt UTSW 15 75657131 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAACCCTGGACTTCATGCCTC -3'
(R):5'- TGTCTACCCCGATCTAGCTG -3'

Sequencing Primer
(F):5'- CCAAAACATTTATCACAGGGGTGTG -3'
(R):5'- CCGATCTAGCTGGCACTG -3'
Posted On2018-08-01