Incidental Mutation 'R6723:Gtpbp2'
ID529724
Institutional Source Beutler Lab
Gene Symbol Gtpbp2
Ensembl Gene ENSMUSG00000023952
Gene NameGTP binding protein 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.228) question?
Stock #R6723 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location46161032-46169370 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 46168276 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 588 (V588A)
Ref Sequence ENSEMBL: ENSMUSP00000024748 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024748] [ENSMUST00000024749] [ENSMUST00000166563] [ENSMUST00000169383] [ENSMUST00000172170]
Predicted Effect probably benign
Transcript: ENSMUST00000024748
AA Change: V588A

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000024748
Gene: ENSMUSG00000023952
AA Change: V588A

DomainStartEndE-ValueType
low complexity region 26 57 N/A INTRINSIC
Pfam:GTP_EFTU 172 412 4.2e-27 PFAM
low complexity region 418 429 N/A INTRINSIC
Pfam:GTP_EFTU_D3 499 589 8.2e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000024749
SMART Domains Protein: ENSMUSP00000024749
Gene: ENSMUSG00000023953

DomainStartEndE-ValueType
Pfam:IMS 12 227 9.7e-53 PFAM
Pfam:IMS_C 308 435 5.8e-15 PFAM
low complexity region 515 529 N/A INTRINSIC
low complexity region 540 561 N/A INTRINSIC
PDB:2I5O|A 606 643 7e-15 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163941
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164338
Predicted Effect probably benign
Transcript: ENSMUST00000166252
Predicted Effect probably benign
Transcript: ENSMUST00000166563
SMART Domains Protein: ENSMUSP00000127896
Gene: ENSMUSG00000023952

DomainStartEndE-ValueType
low complexity region 26 57 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166663
Predicted Effect unknown
Transcript: ENSMUST00000166701
AA Change: V238A
SMART Domains Protein: ENSMUSP00000131772
Gene: ENSMUSG00000023952
AA Change: V238A

DomainStartEndE-ValueType
SCOP:d1f60a2 69 111 1e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167404
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167681
Predicted Effect probably benign
Transcript: ENSMUST00000169383
SMART Domains Protein: ENSMUSP00000133050
Gene: ENSMUSG00000023952

DomainStartEndE-ValueType
low complexity region 26 51 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169778
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169798
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169918
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169955
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171901
Predicted Effect probably benign
Transcript: ENSMUST00000172170
SMART Domains Protein: ENSMUSP00000128517
Gene: ENSMUSG00000023952

DomainStartEndE-ValueType
low complexity region 26 57 N/A INTRINSIC
Pfam:GTP_EFTU 172 411 9.4e-27 PFAM
low complexity region 418 429 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] GTP-binding proteins, or G proteins, constitute a superfamily capable of binding GTP or GDP. G proteins are activated by binding GTP and are inactivated by hydrolyzing GTP to GDP. This general mechanism enables G proteins to perform a wide range of biologic activities.[supplied by OMIM, Jan 2003]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T C 10: 82,289,823 Y2451C possibly damaging Het
Ahnak2 A G 12: 112,778,793 S740P probably damaging Het
Akt3 A T 1: 177,050,190 Y337* probably null Het
Bcl11a C A 11: 24,163,646 P330T probably damaging Het
Cyp2d12 A T 15: 82,556,884 I124F probably benign Het
Dhdds T C 4: 133,994,265 T74A probably damaging Het
Dio3 G A 12: 110,279,557 C109Y possibly damaging Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dock7 A G 4: 99,003,916 V811A possibly damaging Het
Efcab3 A T 11: 105,117,080 T329S possibly damaging Het
Esp1 A T 17: 40,728,856 I11L probably benign Het
Fam13b A T 18: 34,498,026 H33Q possibly damaging Het
Fam13c G A 10: 70,554,525 D539N probably damaging Het
Fgd5 A G 6: 91,988,030 T257A probably benign Het
Gm5134 A G 10: 76,008,619 D603G probably benign Het
Ift140 A G 17: 25,033,116 I312M probably benign Het
Inpp5j T C 11: 3,500,640 N571S probably damaging Het
Iqgap1 T G 7: 80,723,822 D1473A probably benign Het
Ivl T G 3: 92,571,387 K457T unknown Het
Kdm3b T C 18: 34,793,005 I66T probably damaging Het
Kif21a A T 15: 90,940,446 M1430K probably damaging Het
Klhl25 T A 7: 75,865,991 L215Q possibly damaging Het
Lim2 T A 7: 43,435,675 M163K probably benign Het
Lrig1 T C 6: 94,626,405 D254G probably damaging Het
Mff A G 1: 82,751,666 I122V possibly damaging Het
Mrpl15 A C 1: 4,782,566 probably null Het
Mylk A G 16: 34,929,888 Y1199C possibly damaging Het
Nlrp3 G A 11: 59,565,192 C938Y probably damaging Het
Notch1 T C 2: 26,478,106 N623D probably damaging Het
Obscn T G 11: 59,054,998 E4129A probably damaging Het
Olfr1221 G T 2: 89,112,296 T72N possibly damaging Het
Olfr1423 A G 19: 12,036,275 S156P probably damaging Het
Olfr173 T C 16: 58,797,432 K138R probably benign Het
Olfr517 A T 7: 108,868,588 C189S probably damaging Het
Olfr808 A T 10: 129,768,415 L306F probably benign Het
Parm1 C T 5: 91,622,997 P291S probably damaging Het
Pcsk1 T A 13: 75,093,069 probably null Het
Pi4ka A G 16: 17,376,982 L184P possibly damaging Het
Piezo1 T G 8: 122,507,627 Q93H probably benign Het
Pkd2l2 A T 18: 34,438,157 Y575F probably damaging Het
Plekhn1 A C 4: 156,224,569 F258C probably damaging Het
Pole C T 5: 110,323,616 H1409Y probably benign Het
Rae1 T C 2: 173,012,248 I273T probably damaging Het
Rag1 A G 2: 101,643,645 V384A probably damaging Het
Rnaseh1 T C 12: 28,649,762 L25P probably damaging Het
Serpinb12 A G 1: 106,949,158 H68R probably benign Het
Sh3tc2 A T 18: 61,977,954 I294F probably damaging Het
Sirpb1b A C 3: 15,548,798 L75V possibly damaging Het
Slc12a6 A T 2: 112,337,942 T277S probably damaging Het
Slc7a12 A T 3: 14,499,197 E43D probably benign Het
Spata31d1c T A 13: 65,035,944 D433E probably benign Het
Tbl2 A T 5: 135,159,276 Y308F probably damaging Het
Tfec T C 6: 16,835,302 Y159C probably damaging Het
Tmem8 C A 17: 26,120,636 T616N probably damaging Het
Top1mt G T 15: 75,667,433 T371K probably benign Het
Trim24 T C 6: 37,951,468 V541A probably benign Het
Ttc16 T C 2: 32,768,037 Y456C possibly damaging Het
Ttn G A 2: 76,770,097 R17204* probably null Het
Ugt1a6b T C 1: 88,107,717 V259A probably benign Het
Unc5a T C 13: 54,995,889 W129R probably benign Het
Vmn1r63 T A 7: 5,802,949 H228L probably damaging Het
Whamm G T 7: 81,596,120 V775F probably damaging Het
Zfc3h1 T A 10: 115,420,733 I1536N probably benign Het
Zfp1 T C 8: 111,670,339 S317P probably damaging Het
Zfp58 T C 13: 67,494,073 T52A probably damaging Het
Other mutations in Gtpbp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00477:Gtpbp2 APN 17 46168254 missense probably damaging 1.00
IGL01534:Gtpbp2 APN 17 46163504 missense probably damaging 1.00
IGL02272:Gtpbp2 APN 17 46164781 missense probably benign 0.00
IGL02864:Gtpbp2 APN 17 46165594 missense probably benign 0.00
R0894:Gtpbp2 UTSW 17 46165969 missense possibly damaging 0.85
R1575:Gtpbp2 UTSW 17 46165943 missense probably damaging 1.00
R1632:Gtpbp2 UTSW 17 46168592 missense probably benign
R1639:Gtpbp2 UTSW 17 46165771 splice site probably null
R1786:Gtpbp2 UTSW 17 46161202 missense probably benign 0.01
R2132:Gtpbp2 UTSW 17 46161202 missense probably benign 0.01
R2133:Gtpbp2 UTSW 17 46161202 missense probably benign 0.01
R2223:Gtpbp2 UTSW 17 46167227 missense probably benign
R3742:Gtpbp2 UTSW 17 46165882 missense probably benign 0.03
R4060:Gtpbp2 UTSW 17 46167327 missense probably damaging 1.00
R4061:Gtpbp2 UTSW 17 46167327 missense probably damaging 1.00
R4064:Gtpbp2 UTSW 17 46167327 missense probably damaging 1.00
R4387:Gtpbp2 UTSW 17 46166358 missense probably benign 0.03
R4469:Gtpbp2 UTSW 17 46161313 missense probably damaging 0.99
R4583:Gtpbp2 UTSW 17 46161145 missense probably damaging 0.99
R4664:Gtpbp2 UTSW 17 46161154 missense probably benign 0.33
R4724:Gtpbp2 UTSW 17 46167221 critical splice acceptor site probably null
R5338:Gtpbp2 UTSW 17 46167834 missense probably damaging 1.00
R5368:Gtpbp2 UTSW 17 46166304 splice site probably benign
R5832:Gtpbp2 UTSW 17 46167862 missense probably damaging 0.98
R6490:Gtpbp2 UTSW 17 46168221 missense probably benign 0.01
R6526:Gtpbp2 UTSW 17 46164111 intron probably null
R6860:Gtpbp2 UTSW 17 46167988 intron probably benign
R7336:Gtpbp2 UTSW 17 46161313 missense probably damaging 0.99
R7662:Gtpbp2 UTSW 17 46166435 missense probably benign 0.00
R7710:Gtpbp2 UTSW 17 46167787 missense possibly damaging 0.92
R8021:Gtpbp2 UTSW 17 46164269 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- AGTCCCTGGTCACATAACGG -3'
(R):5'- TTGACACCTCTCCAAGAACG -3'

Sequencing Primer
(F):5'- AAAGGCTCCTTCCTGTGGG -3'
(R):5'- TCTCCAAGAACGTGGCAGG -3'
Posted On2018-08-01